ID: 1045229783

View in Genome Browser
Species Human (GRCh38)
Location 8:100292963-100292985
Sequence ATTTTTCCACAGATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045229777_1045229783 16 Left 1045229777 8:100292924-100292946 CCAAACTTTTTGGTACCAGGACC 0: 1
1: 1
2: 33
3: 399
4: 1745
Right 1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG No data
1045229776_1045229783 17 Left 1045229776 8:100292923-100292945 CCCAAACTTTTTGGTACCAGGAC 0: 1
1: 0
2: 29
3: 381
4: 1774
Right 1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG No data
1045229778_1045229783 1 Left 1045229778 8:100292939-100292961 CCAGGACCAATTTCATAGAAGAC 0: 1
1: 1
2: 5
3: 19
4: 150
Right 1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG No data
1045229779_1045229783 -5 Left 1045229779 8:100292945-100292967 CCAATTTCATAGAAGACAATTTT 0: 5
1: 48
2: 480
3: 853
4: 1385
Right 1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045229783 Original CRISPR ATTTTTCCACAGATGGAGGT GGG Intronic
No off target data available for this crispr