ID: 1045231034

View in Genome Browser
Species Human (GRCh38)
Location 8:100307958-100307980
Sequence ACTGTCAACCAGACAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045231034_1045231037 17 Left 1045231034 8:100307958-100307980 CCCAACACTGTCTGGTTGACAGT 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1045231037 8:100307998-100308020 TTAAGTCTACTGATCAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045231034 Original CRISPR ACTGTCAACCAGACAGTGTT GGG (reversed) Intronic
903521530 1:23954445-23954467 ACTGTCAACCAAACACTGTGTGG + Intergenic
904058224 1:27686242-27686264 AATGCCACCAAGACAGTGTTGGG + Intergenic
904240872 1:29144297-29144319 CCTGTGAACCAGATAGTGCTTGG - Intergenic
905906316 1:41620863-41620885 ACTGTGCACCAGGCAGTGCTGGG + Intronic
907198512 1:52706431-52706453 ACTGTCAACCAGTAGGGGTTAGG - Intergenic
908486217 1:64596418-64596440 ACAGTAAACCAGACCCTGTTAGG + Intronic
909694572 1:78451957-78451979 ATTGTCTACCAGTCAGCGTTTGG - Intronic
909700040 1:78512182-78512204 ACTGTGAACCAGGCAGAGGTTGG - Intronic
912498469 1:110106497-110106519 ACTGTCAGCCAGAGAGGGCTGGG + Intergenic
913048937 1:115098555-115098577 ACTGAGAACCAGACACTGATGGG + Intergenic
913471865 1:119196294-119196316 AATTTTAACCAGTCAGTGTTGGG - Intergenic
915767240 1:158374711-158374733 ACTGTTAACCTGACAGTGAGAGG - Intergenic
918446452 1:184621977-184621999 AATGGAAAACAGACAGTGTTGGG - Exonic
922845524 1:228681268-228681290 ACTGTAAACCAGACCGGGTGTGG + Intergenic
924855322 1:247869716-247869738 ACTATCAAGGAGACAGTGTAGGG + Intronic
1064844472 10:19636275-19636297 ATTGTCAGCCAAACAGAGTTAGG + Intronic
1066437427 10:35407210-35407232 ACTGTAAACCAGACTGGGTGTGG + Intronic
1073277810 10:102327831-102327853 ACAGACAGACAGACAGTGTTGGG + Intronic
1074346227 10:112688934-112688956 AATGTCAACCACACACTGCTGGG - Intronic
1074417564 10:113280614-113280636 ATTTTCAACCAGAAAGTGTGTGG + Intergenic
1078512189 11:11993749-11993771 TCTGACAACCACACAGAGTTTGG - Intronic
1078671375 11:13368662-13368684 ACTGACACCTAGCCAGTGTTTGG + Intronic
1079012374 11:16839913-16839935 ACTGTGCACTAGACTGTGTTGGG + Intronic
1079180885 11:18192541-18192563 ACTGGAAATCAGACAGTTTTTGG - Intronic
1079538648 11:21545554-21545576 ACTGTGAACCTGACATTTTTTGG + Intronic
1084407398 11:68982896-68982918 ACTGTTTAGGAGACAGTGTTAGG - Intergenic
1085257290 11:75182325-75182347 AGTGTCACCCAGACAGTTATTGG - Intronic
1088382173 11:109205667-109205689 ACTGTGAACCAGGCAGTTTTAGG + Intergenic
1088589393 11:111390280-111390302 ACTGTCATCCAGTCTGTATTTGG + Intronic
1088796275 11:113269115-113269137 ACTGTCTCCCAGACACTGATGGG + Intronic
1089243340 11:117099536-117099558 ACTGTCAACAAAATAGTCTTTGG + Intergenic
1089662651 11:119995634-119995656 ACTATAAGCCAGGCAGTGTTAGG - Intergenic
1090493278 11:127185056-127185078 GGTGTGAACCAGCCAGTGTTTGG + Intergenic
1090509680 11:127361514-127361536 ACAGACAACCAGACACTGTGTGG - Intergenic
1091617711 12:2062376-2062398 ACAGCCACCCAGACAGTGTTGGG + Intronic
1098864110 12:75742366-75742388 AATGTCAACTAGAGAGTGATGGG - Intergenic
1100128225 12:91456603-91456625 ACAGTAACCCAGACAGTGTCGGG + Intergenic
1102428780 12:112865335-112865357 ACTATCAACCTGACACTGTGGGG + Intronic
1107982613 13:45747989-45748011 ACAGTTAATCAGACAGTTTTTGG + Intergenic
1114248766 14:20939146-20939168 TCTCTCCTCCAGACAGTGTTGGG - Intergenic
1115310100 14:31970257-31970279 ACTGTATACCAGACAGAGCTAGG - Intergenic
1117582026 14:57161042-57161064 ATTGCCAATCAGATAGTGTTGGG + Intergenic
1121066553 14:90972515-90972537 ACTTTTAACTAAACAGTGTTGGG + Intronic
1132245601 15:100293776-100293798 ACTGTAAACCACACAGTGCTAGG - Intronic
1134776443 16:16857785-16857807 ACTGACAAGCCGATAGTGTTTGG - Intergenic
1140551533 16:75871110-75871132 GATGTCAAGCAGACAGAGTTTGG + Intergenic
1141727902 16:85801832-85801854 ACTTTGTACCAGACACTGTTAGG + Intronic
1144366240 17:14547558-14547580 ACTGTGGACCAGGCAGAGTTGGG + Intergenic
1146727477 17:35168098-35168120 AATGCCATCCAGACAGTGTCAGG + Exonic
1149464547 17:56866639-56866661 ACTGTGACCCATGCAGTGTTGGG + Exonic
1150262421 17:63805627-63805649 ACTGCCTACCAGAAAGTTTTGGG + Intronic
1150974348 17:70066848-70066870 ACTTTCAACCAAACAGAATTGGG - Intronic
1151693503 17:75701911-75701933 ACTGTCATCCAGAGAGCGTCAGG + Intronic
1153496920 18:5708971-5708993 AATGTTATCCAGACAGTGTTCGG - Intergenic
1155721867 18:29024379-29024401 ACTTTCATTCAGACAGTCTTGGG + Intergenic
1155954928 18:31948838-31948860 ATTATCAACCAGAAGGTGTTTGG - Intronic
1156447085 18:37245058-37245080 ACAGTCACACAGACAGTGTCTGG + Exonic
1165794971 19:38513781-38513803 ACTTTCAACCATACAGTGAAGGG - Intronic
936838613 2:116740864-116740886 ACTGTCAAGGAGACAGGGGTAGG + Intergenic
939697776 2:145348822-145348844 ACTGTCTATCTGACAGTGATAGG - Intergenic
940382150 2:153027506-153027528 AGTGTCAAGCAAACAGTGGTAGG - Intergenic
942053135 2:172159072-172159094 ACTGTGCACCAGGCACTGTTTGG + Intergenic
943795349 2:191986247-191986269 TCTTTCAAACAGTCAGTGTTTGG + Intronic
947171764 2:227319632-227319654 ATCGTCTACTAGACAGTGTTAGG + Intergenic
948206524 2:236165439-236165461 ACTGAAAAGCAGACATTGTTAGG - Exonic
948684451 2:239661418-239661440 ACTGTCAAGCAGAAAGTGAGAGG - Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1175670350 20:60897234-60897256 ACTGTCCTCCAGTCAGTGTGAGG + Intergenic
1176269493 20:64228461-64228483 ACTGGGAGCCAGACACTGTTGGG + Intronic
1180788362 22:18559259-18559281 ACTGTCAGCCAGACTGTGCCAGG - Intergenic
1181233376 22:21436059-21436081 ACTGTCAGCCAGACTGTGCCAGG + Intronic
1181245274 22:21498784-21498806 ACTGTCAGCCAGACTGTGCCAGG - Intergenic
1184782699 22:46657105-46657127 CCTGTCAAGGAGACAGGGTTGGG + Intronic
949175396 3:1055840-1055862 ACAGTATACCAGACACTGTTTGG - Intergenic
950454479 3:13084442-13084464 ACTGTGTGCCAGACAGTTTTAGG + Intergenic
952296757 3:32068988-32069010 ACTGTAAACCAGACCGGGTGTGG - Intronic
955765001 3:62334160-62334182 ACTGTCAGTCAGAAAGCGTTGGG + Exonic
956388804 3:68749666-68749688 ACTGTTTGCCAGACAATGTTAGG + Intronic
957675316 3:83357062-83357084 ACTGTAAGCCAGACAGGGTGTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962579133 3:136781835-136781857 ACATTCCCCCAGACAGTGTTTGG - Intergenic
966093502 3:176170129-176170151 ACTGTATACCAGAATGTGTTAGG + Intergenic
966969601 3:185031167-185031189 ACTATCAACCAGCCATTCTTAGG - Intronic
974310304 4:60198932-60198954 ACTATCAACAAAAAAGTGTTGGG + Intergenic
975691622 4:76970204-76970226 ACTCTCAACCAGGCAGAGTTAGG + Intronic
975988545 4:80231388-80231410 AATGTCAACCAGACAGGATTGGG + Intergenic
977201700 4:94123868-94123890 ACTCACAACAAGACATTGTTTGG + Intergenic
977575451 4:98669187-98669209 ACTGTCCAGCACACAGTCTTGGG + Intergenic
978919270 4:114162795-114162817 CCTGTCAACAGGACAGTCTTTGG + Intergenic
979480589 4:121212065-121212087 ACTGTATGCCAGAAAGTGTTTGG - Intronic
985935189 5:3092195-3092217 ACTGGGAAGCGGACAGTGTTGGG + Intergenic
988225610 5:28408081-28408103 ATTGTCAACCAGACAGAGTTGGG + Intergenic
989745118 5:44820032-44820054 ATTGGCAACCAGAGAGTATTTGG + Intronic
993782937 5:92090896-92090918 ACTGTGAAGCAGACAGTATTAGG - Intergenic
994119095 5:96093651-96093673 ACTGTCACTTGGACAGTGTTTGG + Intergenic
997265482 5:132492329-132492351 ACTGTCTACCAGATAGAGGTGGG + Intergenic
1001906885 5:175480098-175480120 ACTTTCAAAAATACAGTGTTTGG + Intronic
1002100546 5:176855529-176855551 ACTGTCAGCCAGAAAGTGAGAGG + Intronic
1004333903 6:14746602-14746624 GCTGACAACCAGAAACTGTTTGG + Intergenic
1004475347 6:15966340-15966362 GCTGTGAAACAGACATTGTTGGG - Intergenic
1004775393 6:18838492-18838514 TCTGTAAAGCAGACAGTGTTAGG + Intergenic
1010726774 6:79344106-79344128 ACTGACACCCAGAGAGGGTTGGG - Intergenic
1015794797 6:137000736-137000758 TCTGTAAACTAGAAAGTGTTAGG - Exonic
1017540568 6:155398309-155398331 ACTGTCATCAAGACATTCTTTGG + Intronic
1018459242 6:163981693-163981715 ACTGTCACCAAGACAGTGGATGG - Intergenic
1018480178 6:164182104-164182126 TGTGTCAACCAGAGAGTCTTTGG + Intergenic
1023743417 7:43301185-43301207 GCTGTCTGCCAGACAGTGTTGGG - Intronic
1023908612 7:44538865-44538887 ACAGCCAACCAGACACTGATGGG - Exonic
1026616176 7:71906749-71906771 TCTGGCATCCAGACAGAGTTAGG + Intronic
1029163874 7:98572201-98572223 ACTGTCTTCAAGACAGTGTTTGG - Intergenic
1030099417 7:105932388-105932410 ACTGTCAACTAGAATGTGCTGGG + Intronic
1036422541 8:8611780-8611802 TCTGTCAGCCAGACAGAGGTAGG - Intergenic
1037758090 8:21724309-21724331 ACTTTCATCCAGACATTGCTGGG + Intronic
1042791528 8:72612616-72612638 ACATTGAAGCAGACAGTGTTAGG + Intronic
1045231034 8:100307958-100307980 ACTGTCAACCAGACAGTGTTGGG - Intronic
1052321499 9:27172390-27172412 TCTATCCACCAGACAGAGTTAGG + Intronic
1055179509 9:73367096-73367118 TCTGTCACACAGCCAGTGTTAGG + Intergenic
1056012857 9:82350825-82350847 ACTGTCATGGACACAGTGTTAGG - Intergenic
1057863765 9:98663149-98663171 ACTGTCATCAAGACAGTGGAGGG + Intronic
1058095326 9:100853863-100853885 AATGTGAATCAGACACTGTTGGG + Intergenic
1058800202 9:108538226-108538248 AGTGGCAAGCAGACAGTGTCTGG - Intergenic
1059597662 9:115740175-115740197 ACTGTAGACAAGCCAGTGTTAGG - Intergenic
1060804210 9:126564513-126564535 AGTTTCAACCAGACAGGGTCAGG - Intergenic
1062691448 9:137844126-137844148 ACTGTTAACCAGACTGGGTGTGG - Intronic
1192364138 X:70456804-70456826 ACTGTCAAGCATTCTGTGTTGGG + Intronic
1195767576 X:108312814-108312836 ACACTCAAACAGACATTGTTTGG - Intronic