ID: 1045231214

View in Genome Browser
Species Human (GRCh38)
Location 8:100309520-100309542
Sequence CCGGCCCGGCGATATTATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045231214_1045231226 9 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231226 8:100309552-100309574 GCACAGGCACCAGGAGGACAGGG No data
1045231214_1045231231 19 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231231 8:100309562-100309584 CAGGAGGACAGGGCTTGGGGCGG No data
1045231214_1045231227 14 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231227 8:100309557-100309579 GGCACCAGGAGGACAGGGCTTGG No data
1045231214_1045231225 8 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231225 8:100309551-100309573 CGCACAGGCACCAGGAGGACAGG No data
1045231214_1045231221 0 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231221 8:100309543-100309565 CCGCCGGCCGCACAGGCACCAGG No data
1045231214_1045231223 3 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231223 8:100309546-100309568 CCGGCCGCACAGGCACCAGGAGG No data
1045231214_1045231229 16 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231229 8:100309559-100309581 CACCAGGAGGACAGGGCTTGGGG No data
1045231214_1045231228 15 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231228 8:100309558-100309580 GCACCAGGAGGACAGGGCTTGGG No data
1045231214_1045231218 -7 Left 1045231214 8:100309520-100309542 CCGTCATAATATCGCCGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1045231218 8:100309536-100309558 GGGCCGGCCGCCGGCCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045231214 Original CRISPR CCGGCCCGGCGATATTATGA CGG (reversed) Intronic
900726274 1:4218386-4218408 CAGGCCAGTTGATATTATGAGGG - Intergenic
1067672507 10:48336393-48336415 CAGGCCCTGTGATATCATGAGGG + Intronic
1077546848 11:3175643-3175665 CAGCCCCAGCGATGTTATGAAGG + Intergenic
1098328807 12:69331437-69331459 TCGGCCCGGTGATATTAGGGTGG + Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1181667241 22:24406737-24406759 ACGGCCCGTTAATATTATGACGG - Intronic
1184001256 22:41675300-41675322 CCGGCCCTGGGATATGATAAAGG + Intronic
1020337381 7:7072384-7072406 ACCCCCCTGCGATATTATGAGGG - Intergenic
1045231214 8:100309520-100309542 CCGGCCCGGCGATATTATGACGG - Intronic
1059237980 9:112778566-112778588 CCGGCCCGGCCATATTCTTTTGG + Intronic