ID: 1045231408

View in Genome Browser
Species Human (GRCh38)
Location 8:100310169-100310191
Sequence CGCGGGCGGCGCGCTGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 1, 2: 6, 3: 74, 4: 571}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045231408_1045231420 19 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231420 8:100310211-100310233 ACGCCCACCGGGCCCGCTGCGGG 0: 1
1: 0
2: 0
3: 14
4: 116
1045231408_1045231414 -8 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231414 8:100310184-100310206 CGCCCGCGTGCTGTGCGTCATGG 0: 1
1: 0
2: 0
3: 1
4: 32
1045231408_1045231417 7 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231417 8:100310199-100310221 CGTCATGGCGTCACGCCCACCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1045231408_1045231418 8 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231418 8:100310200-100310222 GTCATGGCGTCACGCCCACCGGG 0: 1
1: 0
2: 0
3: 5
4: 36
1045231408_1045231425 28 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231425 8:100310220-100310242 GGGCCCGCTGCGGGCGGCTCTGG 0: 1
1: 0
2: 1
3: 29
4: 260
1045231408_1045231422 22 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231422 8:100310214-100310236 CCCACCGGGCCCGCTGCGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 159
1045231408_1045231419 18 Left 1045231408 8:100310169-100310191 CCCGCCCCAGCGCGCCGCCCGCG 0: 1
1: 1
2: 6
3: 74
4: 571
Right 1045231419 8:100310210-100310232 CACGCCCACCGGGCCCGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045231408 Original CRISPR CGCGGGCGGCGCGCTGGGGC GGG (reversed) Intronic
900113942 1:1020695-1020717 CCCGGGCGGGGAGCGGGGGCTGG + Intronic
900117312 1:1034166-1034188 CGCGGCAGGTGCGCGGGGGCCGG - Intronic
900127706 1:1075772-1075794 AGCGGGGCGCGGGCTGGGGCTGG + Intergenic
900135751 1:1116246-1116268 CGTGGGTGGGGCGCCGGGGCGGG + Intronic
900237477 1:1599705-1599727 CGCACGCGGCGCGCGGCGGCCGG + Exonic
900237597 1:1600133-1600155 CGCGCACGGGGCGCGGGGGCGGG - Intergenic
900307723 1:2019267-2019289 AGGGAGCGGCGGGCTGGGGCGGG + Intergenic
900548329 1:3241162-3241184 GGCGGGCGGTGAGATGGGGCAGG + Intronic
900549105 1:3245059-3245081 CGCAGGGGGCGGGGTGGGGCGGG + Intronic
900633808 1:3652206-3652228 CGCGGGAGGGGCCCTGGCGCCGG + Intronic
901007699 1:6179842-6179864 CGGGGGCGGCGCGGCCGGGCTGG - Intronic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
901602144 1:10430667-10430689 CGCGGGGGGCGCCCGGGGGCGGG - Intronic
902072186 1:13749512-13749534 GGCGGGCGTGGCGCCGGGGCCGG - Intronic
902072270 1:13749796-13749818 CGCGGACGGCGTTCCGGGGCCGG + Intronic
902375137 1:16026924-16026946 CGGGGGCGGCGGGGCGGGGCGGG + Intronic
903287421 1:22285736-22285758 CCTGGGCGGCGCGCAGGGCCAGG + Intergenic
903950629 1:26994074-26994096 GGGGGGCCGCGCGCTGGAGCTGG + Exonic
904181368 1:28668899-28668921 CGCGGGGGCCGCGCGGCGGCCGG + Intronic
904483295 1:30807393-30807415 GGCGGGCGGCGGCCCGGGGCGGG - Intergenic
904500157 1:30908601-30908623 CGCGGGCGGCGGGCGGCGGGCGG + Exonic
904563392 1:31413324-31413346 AACGGGCGGCGCGCGCGGGCGGG - Intronic
904587663 1:31588961-31588983 GGCGGGCGGGCCGCTGGAGCCGG - Intergenic
905037944 1:34929688-34929710 CGGGGGCGGAGCGCGCGGGCGGG - Intergenic
905174059 1:36125303-36125325 CGCGCTGGGCGCGCTGGGCCGGG - Intergenic
905626286 1:39492164-39492186 GGCGGGTGGCGCGCGGGGCCGGG - Exonic
905670611 1:39788291-39788313 GGCGGGTGGCGCGCGGGGCCGGG + Exonic
905670709 1:39788594-39788616 GGCGGGCGGCGGGGCGGGGCGGG + Exonic
905789680 1:40783599-40783621 CGGGGGCAGCGCGCGGGGCCGGG - Intergenic
905862587 1:41361330-41361352 CGCGGGCGGGGCACCTGGGCTGG + Intergenic
906076908 1:43058624-43058646 GGCAGGGGCCGCGCTGGGGCTGG + Intergenic
906130762 1:43453852-43453874 GGCGGGCGGCGGGCGGGGGCGGG + Exonic
906214313 1:44030352-44030374 CGGGGGCGGGGCCGTGGGGCGGG - Intronic
906214605 1:44031420-44031442 TGCGAGCGGCGCGGCGGGGCGGG - Intronic
906365364 1:45205845-45205867 CCCGGGCTGGGCGCAGGGGCCGG - Exonic
906637160 1:47417142-47417164 AGCGGGCAGCGGGCCGGGGCCGG - Exonic
907920052 1:58903793-58903815 GCCGGGCGGAGCGCCGGGGCGGG - Intergenic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
912246310 1:107965025-107965047 CGCGGGCGCCGCGCTAGGCTCGG + Exonic
912246386 1:107965277-107965299 CGAGGGCGGGGCGCGGGGGAGGG + Intergenic
912301961 1:108526933-108526955 CCTGGGCGGTGGGCTGGGGCGGG - Intergenic
912337538 1:108876894-108876916 GGCGGGCGGCGCAGCGGGGCGGG - Exonic
912360422 1:109090573-109090595 TGCGGGCGTAGGGCTGGGGCTGG - Exonic
912514583 1:110210115-110210137 CAGGGGCGGCGCGCTGGGCTGGG + Intergenic
912514754 1:110210692-110210714 TGCGGGGGCCGCGCTGGGGCGGG - Intergenic
912625759 1:111203888-111203910 CCAGGGCGGCGAGGTGGGGCGGG + Intronic
915740201 1:158113448-158113470 CGCGGGCGGCGGGTGGGGGCGGG + Intergenic
916107278 1:161441200-161441222 CGCGGGGATCGCGCCGGGGCAGG + Intergenic
916108865 1:161448618-161448640 CGCGGGGATCGCGCCGGGGCAGG + Intergenic
916110453 1:161455999-161456021 CGCGGGGATCGCGCCGGGGCAGG + Intergenic
916112038 1:161463409-161463431 CGCGGGGATCGCGCCGGGGCAGG + Intergenic
916113625 1:161470790-161470812 CGCGGGGATCGCGCCGGGGCAGG + Intergenic
916651721 1:166839762-166839784 CCCGGCAGGTGCGCTGGGGCCGG + Intronic
916694418 1:167221404-167221426 CGCGGGCGGGCGGCCGGGGCCGG + Intronic
918042298 1:180920714-180920736 GGCTGGGGGCGGGCTGGGGCTGG + Intronic
918331958 1:183470274-183470296 AGTGGGCGGCGCGTCGGGGCGGG + Intergenic
918332125 1:183471456-183471478 GGCGGGCGGCGGGCTGGAGTCGG - Intergenic
919748648 1:201023555-201023577 CGCGGCCGGCCCCCCGGGGCTGG + Exonic
919920854 1:202165729-202165751 CGGGGGCGGCGGGCGGGGGAAGG - Intergenic
920032649 1:203046462-203046484 CGTGGGAGGCGCACTGGGCCAGG + Intronic
920367617 1:205456398-205456420 CGTGGGCGCCGCGCCGGTGCCGG + Intergenic
921017631 1:211207155-211207177 CGCGGGGGCCGCGCTGGGCCGGG - Intergenic
921051598 1:211515417-211515439 AGCGGGCGCCCCGCTGGGCCTGG - Intergenic
922234538 1:223712939-223712961 GGCCCGCGGCGCGCTGGGGCGGG + Intronic
922496607 1:226062528-226062550 AGCGGGCGGCGCGCGGGGGAGGG + Intronic
922739478 1:228007225-228007247 CGGGCGCGGCGCACAGGGGCAGG - Intronic
923506455 1:234609765-234609787 GGCGGGCGGCGCGGCGCGGCGGG + Intergenic
924436843 1:244049348-244049370 GGAGGGCGGCGGGCTGGGGGAGG + Intronic
924511282 1:244730790-244730812 GTCGGGCGGCGCGCGGTGGCCGG - Intergenic
924524580 1:244835210-244835232 GGCGGGCTGGGGGCTGGGGCCGG + Intergenic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1063663601 10:8049542-8049564 CGCGGGGAGCCCGCTGCGGCAGG - Intergenic
1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG + Intergenic
1064086534 10:12349770-12349792 GGCCGGGGGCGCGCTGGGGAGGG - Exonic
1064552951 10:16521068-16521090 CGCCGCCGGGGCGCTGGGGGTGG - Exonic
1064981751 10:21173370-21173392 CGCGGGCGGATCTGTGGGGCGGG + Intronic
1065025075 10:21534047-21534069 AGCCGGCGGCGCGCGGAGGCCGG - Intergenic
1065140537 10:22714668-22714690 CGCGGGCGGGGCACTGGGTGCGG + Intergenic
1065579323 10:27155292-27155314 CGAGGGCGGGGCGCGGCGGCGGG + Intronic
1067116231 10:43437269-43437291 GGCGGCCGGCGGGCAGGGGCCGG + Intronic
1068845168 10:61663244-61663266 CGTGCACGGCGCGCCGGGGCCGG - Intronic
1068955280 10:62815332-62815354 CGCGGGCGGCGGGCAGGTGGGGG + Intronic
1070327817 10:75399706-75399728 GGAGGTGGGCGCGCTGGGGCCGG + Exonic
1071086832 10:81875260-81875282 CGCGGGCCGGGCGCGGGCGCGGG - Intergenic
1072169792 10:92848422-92848444 CGGGGGCGGGGCGCTCGGGCCGG - Intronic
1073049189 10:100656691-100656713 GGCGGGCGGGGCGCAGCGGCGGG + Intergenic
1073216569 10:101839923-101839945 CGTGGGCGGCGCGGGAGGGCCGG + Intronic
1073268339 10:102241562-102241584 CGCGCGCGGCTCGCCGCGGCGGG - Intergenic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073326102 10:102644589-102644611 CGCGGGCAGGGGGCCGGGGCAGG - Exonic
1073403440 10:103277077-103277099 CTGGGGCGGCGCGCTGGGGGCGG - Intergenic
1073491551 10:103855899-103855921 CGCTGGCTGCGCGCTGGGCTCGG - Intergenic
1074377487 10:112951624-112951646 GGCGGGCAGCGGGCGGGGGCCGG - Intronic
1074377494 10:112951641-112951663 GGCGGGCGGCGCGGGCGGGCGGG - Intronic
1074830129 10:117241849-117241871 CGGGGAAGGGGCGCTGGGGCTGG - Intronic
1075207066 10:120457156-120457178 GGCGGGCGCCGGGCGGGGGCAGG - Exonic
1075940693 10:126388205-126388227 CGCGGGCGCCGAGCCGGGGCCGG + Exonic
1076374241 10:129972844-129972866 TGGGGGCCGCGGGCTGGGGCGGG + Intergenic
1076722204 10:132397562-132397584 GGCGGGCGCCGGGCCGGGGCGGG + Intronic
1076804796 10:132849956-132849978 GGCGGGCCGCGTGCTGGGGCGGG + Intronic
1076880520 10:133237305-133237327 GGGGAGCGGCGCGCGGGGGCGGG - Intergenic
1076986024 11:236461-236483 CGGGGGCGGGGCGCGGAGGCGGG - Intronic
1077008534 11:370015-370037 CGCGGGCGGCGCGGGGGGCGCGG + Intronic
1077026399 11:441833-441855 GGCTGGCGGGGGGCTGGGGCCGG + Intronic
1077204705 11:1336776-1336798 CGGGGGCGGGGCGTGGGGGCGGG + Intergenic
1077204716 11:1336795-1336817 CGGGGGCGGGGCGTGGGGGCGGG + Intergenic
1077214588 11:1390140-1390162 CGCGGGCGGCGCGAAGCAGCGGG + Intronic
1077214679 11:1390416-1390438 CGCTGGCAGCGCGCTGGGTGGGG + Intronic
1077249544 11:1554991-1555013 AGAGGGCGGCTGGCTGGGGCGGG + Exonic
1077413696 11:2414872-2414894 CGCGGGCCCAGCGCGGGGGCAGG - Intronic
1078474765 11:11621282-11621304 GGCGCGGGGTGCGCTGGGGCTGG - Intronic
1078594624 11:12675104-12675126 CGCGGGGGGCGCGGCGCGGCCGG - Intronic
1079076742 11:17389208-17389230 CCCGGGCGGCGGGAGGGGGCGGG - Intronic
1081831602 11:46120386-46120408 CGGGGGCTGCGGGCGGGGGCGGG - Intronic
1083303765 11:61752566-61752588 CGCGTGGGGCGGGCAGGGGCCGG + Intergenic
1083342379 11:61967244-61967266 CCCGGGGCGCGCGCTGGGGCGGG - Intronic
1083346514 11:61997110-61997132 AGCGGGAGGCGCTGTGGGGCTGG + Intergenic
1083648460 11:64186419-64186441 CGCGGGCGGCGGGCGGGAGCGGG + Intronic
1083657040 11:64234718-64234740 CGGGCGCGGCGGGCGGGGGCCGG - Exonic
1083722027 11:64607920-64607942 GGCGGGCGGCGCGCGGCGGGCGG + Exonic
1083939978 11:65890606-65890628 GGCGGGGCGCGCGCCGGGGCGGG - Exonic
1084021341 11:66420066-66420088 CGCGGGCCGGGGGCGGGGGCGGG - Intergenic
1084146192 11:67266561-67266583 CGCGGGCGCCGAGCAGGGCCAGG + Exonic
1084212290 11:67629822-67629844 CGCGGGCCGCGCGCGGAGCCGGG + Exonic
1084946683 11:72642473-72642495 GGCGGGGGGCGGGCCGGGGCGGG - Intronic
1085284640 11:75351752-75351774 GGCGGGCGGCGGGCGGGGACCGG - Intergenic
1085396887 11:76210852-76210874 CGCGCGCGGGGGGCGGGGGCGGG + Intergenic
1086064904 11:82733805-82733827 CGCGCGCGCCGCGCCGGGGCGGG - Exonic
1086337142 11:85811191-85811213 GGCGGGCGGTGCGGTGGGGCCGG + Intergenic
1087076174 11:94128925-94128947 CCAGGGCGGCGCGGAGGGGCAGG + Exonic
1088869008 11:113875603-113875625 CGCGCGCTGCGGGCGGGGGCGGG - Intergenic
1089499809 11:118925471-118925493 CGCGGGCGCCGGGCAGTGGCGGG + Intronic
1090473978 11:127003539-127003561 CGGGGGCGGCGCGCGGGGGAAGG + Intergenic
1090662374 11:128891288-128891310 GGCGGGGGGCGGGCTGGGGTGGG - Intergenic
1090699284 11:129279547-129279569 GGCGGGCGGCGGGCTCCGGCGGG - Intergenic
1091550329 12:1531084-1531106 CGCGGGCGTCGGGTCGGGGCGGG + Intronic
1091585887 12:1816439-1816461 GGCAGGAGGCCCGCTGGGGCAGG - Intronic
1092196960 12:6555517-6555539 CGCGGAGGGCGCGAGGGGGCCGG + Exonic
1092218390 12:6697670-6697692 CACGGGGGGCGGGCTGGGGCTGG + Exonic
1093464861 12:19439411-19439433 GGCGGGCGCCGGGCGGGGGCGGG + Intronic
1095476281 12:42589915-42589937 CTCGGGCCGCGCCCGGGGGCAGG + Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096495449 12:52037135-52037157 CGGGGGAGGCGCGCCGGGGCTGG + Intronic
1096782576 12:53999722-53999744 CGCGGGAGCCCCGCAGGGGCGGG - Intronic
1096870320 12:54588588-54588610 CGAGCGCGCCGGGCTGGGGCCGG - Exonic
1097288723 12:57896698-57896720 CCCGGGCGGCGGGCTGGGCCCGG - Intergenic
1098106009 12:67069419-67069441 CGGGGGCGGGGAGCTGGTGCAGG + Intergenic
1099667351 12:85649376-85649398 CCCGGGCGGAGGGCGGGGGCGGG - Intergenic
1100347010 12:93742388-93742410 CGCGGGCCGCGCAGCGGGGCAGG + Intronic
1100641886 12:96489932-96489954 CGCTGGCGGGGCACTGGGGAGGG + Intronic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1103325359 12:120116657-120116679 CGGGGGCGGTGCGCGCGGGCGGG + Exonic
1103510032 12:121467560-121467582 CGCGGCCGGAGCGCGGGGACTGG + Intronic
1103561082 12:121793594-121793616 CGGGGGCGGCGGTCTGGGCCAGG + Exonic
1103698550 12:122835661-122835683 GGCGGGCGGCGGGCGGCGGCGGG + Intronic
1103758918 12:123233672-123233694 CGCTGGCGGTGGGGTGGGGCCGG + Intronic
1103779437 12:123389212-123389234 GGCGGGCGGCGCGCGGGGCCTGG + Intronic
1103856300 12:123973058-123973080 CGCGCGCCGGGCGCTGGGGTGGG + Intronic
1103954226 12:124567511-124567533 CGCGGGCGCAGGGCTCGGGCGGG + Intronic
1104215114 12:126726886-126726908 CAGGTGCGGCGCGCTGGGGCGGG + Intergenic
1104961518 12:132490419-132490441 GGCGGGCGGCGGGCCGGGCCGGG - Exonic
1105492606 13:20902930-20902952 CCCGGCCGCCGCGCTGGGGCGGG + Intronic
1106517120 13:30465270-30465292 GGCGGGCGGGGCGCCGCGGCGGG - Intronic
1106517168 13:30465408-30465430 CGCGGCCGGGGCGGCGGGGCCGG - Intronic
1107853212 13:44591256-44591278 CCAGGGTGGCGGGCTGGGGCTGG - Intergenic
1108407954 13:50124140-50124162 CGCGGACGGCGCTCTGGGGAAGG + Intronic
1108541695 13:51452348-51452370 CGCGGGCGGCAGGGTGGGGGAGG - Intronic
1110775663 13:79405851-79405873 CGCGGGCGGCGCGCGGAGGAGGG - Exonic
1112290740 13:98142894-98142916 CCCCGGCGGCGCGCTGGGCTCGG + Intronic
1112344286 13:98577149-98577171 CGCGGGGGCCGGGCCGGGGCGGG - Intronic
1113254828 13:108495641-108495663 CGCGGGGGGCGCGCGGGGAGGGG + Intergenic
1113513722 13:110874804-110874826 CGGGGGCGGGGCGCCGGCGCGGG - Intergenic
1113655795 13:112067284-112067306 CGGGAGCGGTGCGCTGGGCCCGG - Intergenic
1113861528 13:113490581-113490603 CGCAGGCGGCGCGCTGGATGTGG - Intronic
1114270765 14:21098530-21098552 GGGGGGCGGCGCGGCGGGGCTGG + Exonic
1117097634 14:52314397-52314419 CGCCGTCGGCGCGCTGGGTGCGG + Exonic
1118809124 14:69260821-69260843 CGCTCGCCGCGCGCTGGGCCCGG - Intronic
1120190562 14:81436234-81436256 AGCGGGCGGGGGGCGGGGGCGGG - Intronic
1121473446 14:94174245-94174267 CGCGGGCGGGCTGCGGGGGCGGG - Intronic
1121616985 14:95319915-95319937 CGCGGGCGGGGCGCGGGCGCGGG + Intergenic
1122294244 14:100696204-100696226 CGGGGGCGGCTAGCAGGGGCCGG - Intergenic
1122543302 14:102509498-102509520 CGCGGGCGCGGCGCGGGGGACGG + Intronic
1122635304 14:103126957-103126979 GGTGGGCGGTGGGCTGGGGCCGG + Intronic
1122666753 14:103334934-103334956 CTCGGGGGACGCGCTGGGGATGG + Intronic
1122959604 14:105088345-105088367 CCCGGGCGGAGGGCTGGGGGCGG + Intergenic
1122960896 14:105093299-105093321 TCCGGGCGGCGCGCAGGCGCGGG - Intergenic
1122978534 14:105181018-105181040 CGGGGGCGGGGCTCCGGGGCGGG + Intronic
1123004466 14:105314710-105314732 CGCGGGCGGGGCGCCGGGCGGGG + Exonic
1123036595 14:105474353-105474375 CGCGCGCGGCGGGGTGGGGGTGG + Intronic
1123500664 15:20878228-20878250 CGCGGGCTGCGTGGTGGGCCAGG + Intergenic
1123500813 15:20878825-20878847 CAGGGCCGGCGCGCAGGGGCAGG - Intergenic
1123557909 15:21451921-21451943 CGCGGGCTGCGTGGTGGGCCAGG + Intergenic
1123558064 15:21452520-21452542 CAGGGCCGGCGCGCAGGGGCAGG - Intergenic
1123594138 15:21889202-21889224 CGCGGGCTGCGTGGTGGGCCAGG + Intergenic
1123594292 15:21889801-21889823 CAGGGCCGGCGCGCAGGGGCAGG - Intergenic
1123716758 15:23039347-23039369 CGCGGGCTCCGGGCTGTGGCCGG + Intronic
1124629475 15:31328259-31328281 CGCCCGCCGCGCGCCGGGGCCGG - Intronic
1127606487 15:60592359-60592381 CCCGGGCGCCCCGCCGGGGCCGG - Intronic
1127877240 15:63121994-63122016 CGGGGGCCTCGGGCTGGGGCTGG + Exonic
1127893780 15:63277460-63277482 CGGGGGCGGGGCTCGGGGGCGGG - Intronic
1128111279 15:65077685-65077707 CGCCGGCGGCCGGCTGCGGCAGG - Exonic
1128263938 15:66252282-66252304 CGCCGGAGGGGCGCTGGTGCCGG + Intronic
1129274057 15:74433871-74433893 GGCGCGCGGTGCGCTGGGGGCGG + Exonic
1129387247 15:75202652-75202674 CGCGGGCGTCGGTGTGGGGCTGG + Intronic
1129710747 15:77819270-77819292 CGCGGACGGCGCGCCCGGGACGG - Intronic
1130128823 15:81118573-81118595 CGCGGGGGGCTCGCGGTGGCGGG + Intronic
1130967074 15:88705492-88705514 CCCGGGCGGCGCGCGGCGGGCGG - Intergenic
1131367834 15:91854311-91854333 CGCGCGCGTCCGGCTGGGGCAGG + Intronic
1131493583 15:92883102-92883124 CGCGGGCGGGAGGCTCGGGCGGG + Intergenic
1131517616 15:93089327-93089349 GGCGGGGGGCGCGCGCGGGCGGG + Intergenic
1202966260 15_KI270727v1_random:179093-179115 CGCGGGCTGCGTGGTGGGCCAGG + Intergenic
1202966414 15_KI270727v1_random:179692-179714 CAGGGCCGGCGCGCAGGGGCAGG - Intergenic
1132512661 16:352237-352259 GGCGCGCGGGGAGCTGGGGCCGG - Intronic
1132567499 16:630174-630196 CGCCGACGGGGGGCTGGGGCAGG + Intronic
1132586004 16:705970-705992 AGCGCGCCGCGCGCGGGGGCCGG - Intronic
1132719667 16:1309535-1309557 CGCGGGAGGCGCTCGGGGCCGGG + Intronic
1132719682 16:1309611-1309633 CGCGGGCGGGGCGCGCGGGGCGG - Intronic
1132735796 16:1385266-1385288 CGCGGGCAGCGCAGTGGGGGAGG + Intronic
1132778877 16:1612338-1612360 CACGGACGGCGCGCGGGGGCGGG - Exonic
1132779303 16:1614187-1614209 CGAGGCCGGCGCGCAGGGCCAGG + Intronic
1132880838 16:2161075-2161097 GGCGGGCGGGACCCTGGGGCTGG - Intronic
1132991611 16:2798490-2798512 CGCGCGCGGGGCGCTGCTGCTGG + Intergenic
1132994773 16:2817274-2817296 CGCGCGCGGGGCGCTGCTGCTGG + Exonic
1134134133 16:11668554-11668576 GGCAGGCCGCGCGCTCGGGCCGG + Intronic
1136993297 16:35170281-35170303 CGCGGGCGGCGGCTGGGGGCCGG - Intergenic
1137655234 16:50153456-50153478 CGCGGGCGGCGCGGTCGCGCAGG - Intronic
1138247674 16:55479447-55479469 CCCGGGCGACGCGCGGGGCCAGG + Exonic
1138379319 16:56589435-56589457 CGGGCGCGGTGCGCAGGGGCGGG + Exonic
1141132192 16:81444509-81444531 AGGGGGCGGGGCGCGGGGGCGGG - Intergenic
1141418939 16:83899237-83899259 GGCGGCCGGCGCCCTGGAGCGGG + Exonic
1141430579 16:83968656-83968678 AGCGGGCGGCGCGCCTGTGCAGG + Exonic
1141683357 16:85556578-85556600 CGGCGGCGGCGCGATGGGGGCGG - Intergenic
1142474687 17:181728-181750 CGCGGGCGGCGCGGAGCGGAGGG + Intergenic
1142586822 17:979277-979299 CGTGGGGGGCGGGCAGGGGCCGG + Intronic
1142665768 17:1462917-1462939 AGAGGGCGGCGCGCTGTGGGTGG - Intronic
1142666649 17:1467451-1467473 CGCGGGCGGCCCCCGGGGACAGG - Intronic
1142670630 17:1485934-1485956 CGCGGGCCGGGGGCGGGGGCGGG + Intronic
1142812606 17:2402142-2402164 GGTGGGCGGGGCGCGGGGGCGGG + Intergenic
1142876063 17:2852928-2852950 CGCGCGCGGCTGGCAGGGGCGGG + Intronic
1142876308 17:2853683-2853705 CGCGGGCGGCGCGTCTGAGCGGG + Intronic
1143118701 17:4594600-4594622 CACGGGCTGCGAGCAGGGGCAGG + Intronic
1143830377 17:9645887-9645909 CGCCGGCGGGGAGCTGGAGCTGG - Exonic
1144206042 17:12980183-12980205 TGCAGGCGGCTGGCTGGGGCTGG - Exonic
1144339375 17:14299674-14299696 CCCGGGGGTCGCGCTGGGGTCGG + Intergenic
1144586671 17:16491704-16491726 CGCGGGGGGCGCGCCGGGCCAGG - Intronic
1144608833 17:16690610-16690632 GGCGGACGTCGTGCTGGGGCTGG - Exonic
1144903991 17:18625216-18625238 GGCGGACGTCGTGCTGGGGCTGG + Intergenic
1145243517 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG + Intronic
1145962922 17:28897746-28897768 CGGGGCCGGCGCGTTGAGGCAGG + Intergenic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1147015799 17:37490218-37490240 CGGGGGCGGCGCGGCGCGGCGGG - Intronic
1147028435 17:37609455-37609477 CGCGGACCGGGCGATGGGGCGGG + Exonic
1147139673 17:38454000-38454022 CGCGTGGAGCGCGCGGGGGCCGG + Intronic
1147150296 17:38510289-38510311 AGCGGTCGGCGGGCAGGGGCGGG + Exonic
1147259041 17:39197860-39197882 TGCAGGCGGCCCGCTGGGGCGGG + Intergenic
1147317369 17:39627366-39627388 CGCGGGGTGGGCGGTGGGGCTGG - Exonic
1148178027 17:45584703-45584725 CCCGGCCGGGGCGCTGGTGCTGG + Intergenic
1148534828 17:48430291-48430313 CGCGGGCGGCAGGCGGGGACCGG + Intergenic
1148652614 17:49260558-49260580 AGCGAGCGGCGGGCAGGGGCCGG - Intergenic
1148861734 17:50608097-50608119 AGGGGGCTGGGCGCTGGGGCCGG + Intronic
1150217061 17:63476879-63476901 CGGGGGTGGCGGGATGGGGCTGG - Intergenic
1150407915 17:64918989-64919011 CCCGGCCGGGGCGCTGGTGCTGG + Intronic
1151767919 17:76141493-76141515 CGAGGGCCCCGCGCTGGGGTCGG + Intergenic
1151783900 17:76265806-76265828 CGCGGGCCGGGCGCGGAGGCGGG + Intronic
1151802044 17:76384504-76384526 CGGAGGCGGCGCGCTGAGGCCGG + Intronic
1152111626 17:78360234-78360256 GGCGGGCCGCGAGCAGGGGCAGG + Intergenic
1152222148 17:79074841-79074863 CGCTGACGCCGCGCTGGGACGGG - Intergenic
1152349801 17:79778201-79778223 GGCGGGCGCCGCGGTCGGGCTGG + Exonic
1152357464 17:79813868-79813890 CCCGGCCGGCCCTCTGGGGCTGG - Intergenic
1152362493 17:79839149-79839171 CGGGGGCGGCGAGCGGCGGCCGG - Intronic
1152463859 17:80455043-80455065 GGAGGGCGGCGGGCCGGGGCGGG - Intergenic
1152463979 17:80455450-80455472 CGGAGGCCGAGCGCTGGGGCTGG - Intergenic
1152519299 17:80845956-80845978 AGCTGGGGCCGCGCTGGGGCCGG - Intronic
1152552114 17:81035066-81035088 CGGGGGCGGGACGCAGGGGCGGG + Intergenic
1152655851 17:81518976-81518998 CCCCCGCGGCGCGCTGGGGAAGG - Intronic
1152677311 17:81648251-81648273 AGCGGGCGGGGCGCCGGGGCTGG - Exonic
1152708938 17:81860592-81860614 CGCGGCCAGCGCGCGCGGGCGGG - Exonic
1153855062 18:9137124-9137146 GGCGGGCGGCGCGTCGGGACCGG - Intronic
1155053206 18:22165653-22165675 CGCCGGCGGCGCACGGGGGTCGG + Intergenic
1156099722 18:33578693-33578715 CGCGGGCGGCGTGTGGGGGGCGG - Intronic
1156502021 18:37566142-37566164 GGCGGGCGGCGGCCGGGGGCAGG + Intergenic
1157094878 18:44679212-44679234 AGCGGGAGGGGCGCTGGGGGCGG + Intergenic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157545159 18:48541225-48541247 GGCGGGCGGCGGCCTGGGCCGGG - Intronic
1157752938 18:50194731-50194753 CGAGGGAGGCGCCCCGGGGCCGG - Intronic
1159040601 18:63320103-63320125 GGCAGGCGGCGCGGAGGGGCGGG + Exonic
1159798225 18:72868200-72868222 CGCGGCCGGCGCCCCGGGGCTGG + Intergenic
1160745429 19:709077-709099 CGCGGGTGGCGCGCGGGGGAGGG - Intronic
1160812972 19:1020914-1020936 CGAGGCCCGCGCGCGGGGGCCGG + Exonic
1160860873 19:1236837-1236859 CGGGGGCGGCGGCCTGGGGGGGG + Intronic
1160919668 19:1513602-1513624 CGTGGGCCGCGCGCGGGGGGCGG + Intronic
1160979880 19:1812040-1812062 CGCGGTCGGGGCCCCGGGGCGGG - Intronic
1161210358 19:3062421-3062443 GGCGGGCGGCGGGGAGGGGCGGG - Intronic
1161216197 19:3096021-3096043 CGGGGGCGGGGCGGTGGGGAAGG + Intronic
1161222027 19:3122308-3122330 CGGGGGCGGCGCTCGGGGGCGGG - Exonic
1161264841 19:3359471-3359493 CGCGGGCGGTGCGCGGGACCGGG + Intergenic
1161299256 19:3534948-3534970 GGCGGGCGGGGAGCTGGGCCTGG + Intronic
1161400658 19:4065360-4065382 CGGGGGCCGCGCGCTGCGGCCGG - Intronic
1161560393 19:4969509-4969531 GGCCGGGGGCGCGCGGGGGCTGG + Intronic
1162561292 19:11419343-11419365 GGCGGGCGGCGGGCAGTGGCCGG + Intergenic
1162591976 19:11597804-11597826 CGCAGGCGTCGCGCAGGGACGGG - Intronic
1162751827 19:12834040-12834062 AGGGGTCGGCGCCCTGGGGCGGG + Intronic
1163012228 19:14433397-14433419 AGCGGGCCGCGCGCCGGGGAGGG + Intronic
1163113839 19:15177860-15177882 CGCGAGCGGCGCGGGGCGGCAGG + Exonic
1163117206 19:15195864-15195886 GGCGGGGCGCGGGCTGGGGCTGG - Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163155653 19:15438797-15438819 GCTGGGCGGCCCGCTGGGGCTGG - Intronic
1163427143 19:17245894-17245916 CGCCGGCCTCGCGCTGCGGCCGG + Exonic
1163427163 19:17245943-17245965 GGCGGGCGGGGGGCGGGGGCGGG + Intronic
1163427175 19:17245974-17245996 CGCGCGCCGCGGGCTGGGGGCGG + Intronic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1163553810 19:17981629-17981651 CTCTGGGGGCGCGGTGGGGCTGG + Intronic
1163666451 19:18606142-18606164 CGCGGTTGGCGCGCTGGGTGCGG - Intronic
1164189579 19:22901838-22901860 CGTGGGCGGCGCAGTGGGGGCGG - Intergenic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1165157145 19:33795802-33795824 CGCGCGCGGCGCGATGGAGACGG - Intergenic
1165311351 19:35030868-35030890 CGCGGGGGGCGCGCGCGGCCGGG + Intronic
1165428339 19:35757595-35757617 CGGGGGCCGCGCGCTGGGGCTGG + Intronic
1165443511 19:35844231-35844253 CGGGGGCCGCCCGCTGGGGAAGG + Exonic
1165468194 19:35987412-35987434 CAGGGGCGGAGCGCGGGGGCGGG - Intergenic
1165511861 19:36270752-36270774 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165512413 19:36273253-36273275 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165512960 19:36275794-36275816 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165513516 19:36278349-36278371 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165514066 19:36280883-36280905 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165514618 19:36283420-36283442 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165515170 19:36285953-36285975 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165515720 19:36288489-36288511 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165516271 19:36291026-36291048 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165516823 19:36293552-36293574 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165517376 19:36296075-36296097 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165517928 19:36298610-36298632 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165518479 19:36301145-36301167 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165519028 19:36303677-36303699 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165519578 19:36306192-36306214 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165520128 19:36308720-36308742 AGCCGGCGGCGGGCTGGGGGTGG + Intergenic
1165623940 19:37269861-37269883 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165624486 19:37272402-37272424 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165625029 19:37274929-37274951 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165626103 19:37279992-37280014 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165626644 19:37282519-37282541 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165627184 19:37285040-37285062 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165628263 19:37290092-37290114 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165628803 19:37292617-37292639 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165629345 19:37295143-37295165 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165629886 19:37297668-37297690 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165630429 19:37300196-37300218 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165630966 19:37302734-37302756 AGCCGGCGGCGGGCTGGGGGTGG - Intergenic
1165742597 19:38212414-38212436 CGGGGGTGGGGGGCTGGGGCAGG + Intronic
1166039064 19:40191461-40191483 CACGGGCGGGGGGCAGGGGCTGG + Intergenic
1166215376 19:41331212-41331234 TGCGGGCGGCGGGCGGGGTCAGG + Intronic
1166547042 19:43639888-43639910 CGGGGGCGGGGCGCCGAGGCCGG + Intergenic
1166564338 19:43754591-43754613 GGCGGGCGGGGCGCTCCGGCAGG - Intronic
1166721798 19:45001420-45001442 GGCGGGCGGCGGGCGGGGGCGGG - Exonic
1166869751 19:45864224-45864246 CGAGGGCGGCGCGCTCGGACTGG - Intronic
1167074291 19:47239625-47239647 CGGGGGCCGCGCGCTGTTGCTGG + Intergenic
1167120777 19:47515150-47515172 CACGGGCGGCGTGCGGCGGCTGG - Exonic
1167258152 19:48443151-48443173 CGCGGGCGGCGCGGGGGGCACGG + Exonic
1167311195 19:48738931-48738953 GGCGGGCGGGGCTCTGGGGCGGG - Intronic
1167486651 19:49766941-49766963 CGCGGGCGGAGGGGAGGGGCAGG + Intergenic
1167557062 19:50203349-50203371 CGCGGGGGGCGGCCGGGGGCGGG - Intronic
1167744950 19:51345270-51345292 CGCCGGCCGTGCGCTGGGGCGGG + Exonic
1168238218 19:55076486-55076508 GGCGGGAGGCGTGCTGGGGCTGG - Intronic
1168332679 19:55579249-55579271 CGCGGGCGGCGAGGTCGAGCTGG - Exonic
1168538526 19:57191711-57191733 CAGGGGCGGCGCCCTGGGTCTGG + Exonic
1168721788 19:58558435-58558457 CGCGGGCGGCGGCGGGGGGCCGG - Exonic
1168728656 19:58606927-58606949 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728664 19:58606957-58606979 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728687 19:58607047-58607069 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
925068907 2:951014-951036 CGCGGGAGGCGGCCGGGGGCGGG - Exonic
925984802 2:9206948-9206970 CGCGGGAGCCGCGCGGGGCCTGG - Exonic
926035281 2:9631083-9631105 GGCCAGCGGCGCGCTGGGGGCGG - Intergenic
927053430 2:19350636-19350658 CGCGGTCAGGGCGCTGGAGCTGG + Intergenic
927125962 2:20012600-20012622 GGGAGGCGGCGCGCGGGGGCCGG + Exonic
927129485 2:20046198-20046220 AGCGGGTGGCGGGCTGGGGGAGG + Intronic
927561375 2:24076587-24076609 GGAGGGCGGAGAGCTGGGGCGGG + Intronic
927667345 2:25041965-25041987 CGGGGGCGGGGCGCAGGGGCGGG + Intergenic
927692238 2:25216247-25216269 GGCTGGCGGCGCGCTGGGCCTGG - Intergenic
927971209 2:27307193-27307215 CGAGGGCGGGGCGGTGGTGCCGG + Exonic
928094080 2:28393389-28393411 CTCCGGCTGCGCGCGGGGGCGGG + Exonic
931291961 2:60881426-60881448 CAGGGGCGGGGCGCTGGGGGCGG + Intergenic
931882507 2:66581955-66581977 CGCGGGTAGCGCGCTGTGCCCGG + Intergenic
932456399 2:71852458-71852480 CGGGGGCGCCGAGCTGAGGCGGG - Intergenic
932613166 2:73214477-73214499 CCCGGGCCGCGAGCAGGGGCAGG - Intronic
932776380 2:74530407-74530429 AGCGGGCGGCGGGCTAGGGACGG - Exonic
933772678 2:85754165-85754187 CGCGGGCGGCGCGCGAGGCAGGG - Exonic
934079121 2:88452466-88452488 CGGTGGCGGCGGGCGGGGGCAGG + Exonic
934763887 2:96869891-96869913 CGAGGGCGGCGCCCGGGGACTGG - Exonic
934966826 2:98731007-98731029 CAGCGGCGGCGCGCGGGGGCGGG - Intronic
935275797 2:101474391-101474413 CGCGGGGGGCGCGCGGGGCGCGG + Intronic
935592035 2:104853319-104853341 CGCGGGCACCGCGCTGGTCCTGG + Intergenic
935593755 2:104863956-104863978 CCCGTGCGGCGCGCAGGGCCTGG - Intergenic
936452885 2:112646337-112646359 CGCGGAGGGCGCGCGCGGGCTGG + Intronic
937653576 2:124348057-124348079 CGCGGGCGGCTCACTAGGTCAGG - Intronic
937956256 2:127423194-127423216 GGCGGGCGGCGGGGCGGGGCTGG + Intronic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
940316835 2:152335582-152335604 TGTCGGCGGCGCGCCGGGGCCGG - Exonic
940646787 2:156400314-156400336 CGCGGCCCGAGCGCTGGGCCCGG + Intergenic
941385069 2:164841892-164841914 CGCGGGCGGGGTGCGGGCGCTGG + Intronic
941580692 2:167293115-167293137 CGCCGGCGGCGCGGCGGGGTGGG - Intergenic
941929924 2:170929274-170929296 AGCAGGCGGTGCGCTGGGGGCGG + Exonic
942184983 2:173416330-173416352 CACGGCCGGCGCACTGGCGCTGG - Intergenic
942454743 2:176130070-176130092 GGGCGGCGGCGCGCGGGGGCTGG + Exonic
942928123 2:181457465-181457487 CGCGGGCGGAGCGTTCGGGCCGG - Exonic
942965772 2:181891661-181891683 CGCGCGGGGCGCGGTAGGGCGGG - Intergenic
945045287 2:205776334-205776356 CGGGGGCGCCGTGCTGGTGCTGG + Intronic
946231297 2:218292556-218292578 CGAGGCCGGCGCGACGGGGCGGG - Intronic
946386615 2:219387813-219387835 GGCAGGCGGCGCGGTGGGGGCGG - Exonic
947800829 2:232927851-232927873 CGGGGGCGGCGCGCCGGGGCCGG + Intronic
1168756767 20:324171-324193 CGCGGGGGGCGGGGTGGGGGTGG - Intergenic
1168800928 20:642723-642745 GGAGGGCGGCGCGCGTGGGCCGG + Intergenic
1169437978 20:5610715-5610737 CGCGGGCGGGGTCCTCGGGCCGG - Intronic
1170999216 20:21396673-21396695 CGCGCGGGGCGTGCTGGGGCCGG - Intronic
1172109403 20:32536474-32536496 CTCGGGCGGGGGGCAGGGGCGGG + Intronic
1172282845 20:33720210-33720232 TGCGGGCTGCGCGCAGGGTCGGG + Exonic
1172320894 20:33994333-33994355 CGGGCGCGGAGGGCTGGGGCCGG - Intronic
1172408078 20:34704160-34704182 TGCGGGCCGGGCGCTCGGGCCGG - Intronic
1172409093 20:34709271-34709293 GGAGGGCGGCCCGCGGGGGCAGG - Exonic
1172644488 20:36461405-36461427 CGCGGGGGGCGGGGAGGGGCGGG + Intronic
1172702935 20:36863700-36863722 CGCGGGGGGCGGGCTGCGCCGGG - Intergenic
1172771814 20:37386492-37386514 CGTGGGCGGCGGGCTGGGCGGGG + Intronic
1173279749 20:41618011-41618033 TGCGGGCCGCGCGCAGGGGCGGG - Intronic
1173548137 20:43914781-43914803 CGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1174204343 20:48828025-48828047 CGGAGGCAGCGCGCGGGGGCCGG + Intergenic
1175210482 20:57350923-57350945 GGGGGGCGGCGCGGGGGGGCGGG + Intergenic
1175260671 20:57672368-57672390 GGCGGGCGGCGCCCAGGGGAGGG + Intronic
1175394645 20:58650262-58650284 CTCCGGCCGCGCGCTGGGCCAGG + Intergenic
1175429262 20:58890969-58890991 CGCGGGCGCCGCCGAGGGGCTGG - Intronic
1175562308 20:59940438-59940460 CGGCTGCGGCGCGCTGCGGCAGG - Intronic
1175877799 20:62238654-62238676 CCTGGGCCGCGGGCTGGGGCTGG + Intronic
1175950861 20:62582383-62582405 TGGGGGCGGGGCGCGGGGGCGGG - Intergenic
1175994116 20:62804780-62804802 CGCGGGGGGCGGGCGGGGGGAGG - Intergenic
1176005796 20:62861706-62861728 CGCGGGCGGCGGGCGGCGGGAGG + Exonic
1176125349 20:63472505-63472527 CGGGGGCGGAGCGCGGGGGGCGG + Exonic
1176414800 21:6468056-6468078 AGGGGGCGCCGCGCCGGGGCGGG + Intergenic
1177894556 21:26844459-26844481 CGCTGGCGGCGGGCAGCGGCTGG + Exonic
1178513838 21:33229910-33229932 CGCGGGCGCCGCGCCGCCGCCGG - Intronic
1178610189 21:34073372-34073394 CGCGGCCGGCGGGCTGGGCTGGG + Intronic
1178951571 21:36990095-36990117 CGCCGGGGGCGTGCTGGGGCCGG - Intronic
1179690300 21:43076378-43076400 AGGGGGCGCCGCGCCGGGGCGGG + Intronic
1180614762 22:17120215-17120237 CGCGGGGGGCGGCCTGGGGGCGG - Exonic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1180791490 22:18577722-18577744 CGCGGGGAGCGGGCGGGGGCCGG - Intergenic
1181006659 22:20016761-20016783 CTCGGGTTGCGCGCTGGGCCTGG - Exonic
1181057857 22:20268325-20268347 CGTGGGCGGCGCGGCGGGCCGGG + Exonic
1181094469 22:20495953-20495975 CGCGGGGGCGGCCCTGGGGCGGG + Intronic
1181230249 22:21417589-21417611 CGCGGGGAGCGGGCGGGGGCCGG + Intronic
1181248401 22:21517274-21517296 CGCGGGGAGCGGGCGGGGGCCGG - Intergenic
1181457967 22:23070371-23070393 GGCGGGCGGCGCGGGAGGGCGGG + Exonic
1181631893 22:24155974-24155996 CGCTCGCGGCGGGCCGGGGCGGG - Intronic
1182092237 22:27603712-27603734 GGCAGGCGTCGCGCTGGGCCAGG + Intergenic
1182289831 22:29268560-29268582 CGCGGGGGGCTTGCTGCGGCGGG + Intronic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1183211653 22:36455083-36455105 CGCGGACGGCGGACTGGGCCGGG + Intergenic
1184086924 22:42270747-42270769 CGGGGGCGGGGCGCTGGGGGCGG + Intronic
1184276510 22:43412061-43412083 GGAGGGAGGCGCGCAGGGGCGGG - Intronic
1184680914 22:46071712-46071734 CGCGGCCGGCGCGCTCGGGCGGG + Intronic
1184797026 22:46738424-46738446 CGAGGCCAGGGCGCTGGGGCCGG + Intergenic
1185268660 22:49918445-49918467 CGCGGGCTGCGCGCGAGGGGCGG + Exonic
1185285875 22:49999705-49999727 CGGGGGCGGGGCGCGGGGGGTGG + Intronic
949915736 3:8963215-8963237 CGCGAGCGTCGCACTGGGCCCGG - Intronic
950008242 3:9704815-9704837 CCCGGGCGACGCCCTGGGCCGGG - Intronic
950024353 3:9810265-9810287 CTGAGGCGGCGCGCAGGGGCGGG - Exonic
953485038 3:43286828-43286850 CCCGGGCCGCGCGCTGCGGCCGG - Intronic
954110252 3:48429500-48429522 CCCGGGCGGCGGGCGGGGGGAGG - Intronic
954146153 3:48635317-48635339 CGCGAGCGCCTCGCTGGAGCAGG - Intronic
954200067 3:49018714-49018736 CGCGGAAGGGGCGCTGGGGGCGG - Intronic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954912640 3:54122221-54122243 CGCGGGCGCGACTCTGGGGCTGG - Intergenic
956659451 3:71583636-71583658 CGCGGGGTGCGCGCGCGGGCGGG - Intronic
959539813 3:107525075-107525097 TGGCGGCGGCGCGCAGGGGCGGG - Intronic
960884927 3:122384151-122384173 CGCAGGCGGCGCCGGGGGGCGGG - Intergenic
960955403 3:123027510-123027532 CCCGGGCGGCGCGGAGCGGCGGG + Intronic
961377323 3:126475668-126475690 GGCGGGCGGCGGGCTTGGCCCGG + Exonic
961780025 3:129315921-129315943 GGCGGGCGGCGCGCGGAAGCCGG + Exonic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
963939570 3:151085905-151085927 CGCGGCTAGCGGGCTGGGGCTGG - Intronic
965644921 3:170870283-170870305 AGCGGGAGGAGCGCTGAGGCCGG + Exonic
966743386 3:183254055-183254077 CGGGGGCGGGGCGGAGGGGCCGG - Intronic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
967849450 3:194071075-194071097 CGCGGGTGGCGCCCGGGGCCGGG + Intergenic
968186957 3:196639628-196639650 CGCGGGCGCGGGGGTGGGGCGGG - Intergenic
968372777 4:11124-11146 CGCCGGCGCGGCGCCGGGGCGGG + Intergenic
968372792 4:11173-11195 CGCCGGCGCGGCGCCGGGGCGGG + Intergenic
968372828 4:11296-11318 CGCCGGCGCGGCGCCGGGGCGGG + Intergenic
968433962 4:575720-575742 CGCGGCCGGGGCCCCGGGGCCGG - Intergenic
968479171 4:826232-826254 CGCGGGCGCCGGGCGGGGGCGGG + Intergenic
968479241 4:826343-826365 CGGGGGCGGGGGGCGGGGGCGGG + Intergenic
968479295 4:826428-826450 CGGGGGCGGGGGGCGGGGGCGGG + Intergenic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968756056 4:2417256-2417278 CGAGGGTGGCACCCTGGGGCCGG - Intronic
968764785 4:2462666-2462688 CGGGCGCGGCGCGCAGGGACCGG + Intronic
968815175 4:2818240-2818262 CGCGGCCGCGGAGCTGGGGCCGG + Exonic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
968949557 4:3683521-3683543 CGCGGGCCCCACGCTGGGCCTGG + Intergenic
968965569 4:3767548-3767570 CGCGGGCGGTGCGGACGGGCAGG + Exonic
969285646 4:6200457-6200479 CGCGCGCGGCTCGGCGGGGCGGG + Exonic
971405622 4:26319473-26319495 GGCGGGCGGCGGGCGCGGGCGGG - Intronic
972533066 4:39977589-39977611 CCCGGGAGCGGCGCTGGGGCTGG + Exonic
973774552 4:54231994-54232016 CGTGGGCGGCGCGCAGCGGCGGG + Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
975965212 4:79964896-79964918 CGCGGGCCGCACGCCGGGCCCGG - Intronic
976184168 4:82429198-82429220 CGCGTGCGGCGCGCTGGGGGAGG + Intronic
981033874 4:140151674-140151696 CCCGGGCGGCGCGGTGCGGGGGG + Intronic
983537866 4:168877800-168877822 CGAGGGCGGCGCGCTGCGCGGGG - Intronic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
984801807 4:183722996-183723018 CGAGGCGGGCGCCCTGGGGCTGG + Intergenic
984811309 4:183798134-183798156 TGCCCGCGGCGGGCTGGGGCAGG - Intergenic
984995451 4:185426038-185426060 CGCGGACGGCGAGGCGGGGCGGG + Intergenic
985064062 4:186104741-186104763 CGCGGGCGGCGGGCGGCGGGCGG + Intronic
985462617 4:190121442-190121464 CGCCGGCGCGGCGCCGGGGCGGG - Intergenic
985703231 5:1386115-1386137 CACGGGCGGGGCTCTGGGGCCGG + Intergenic
985896097 5:2750929-2750951 CGCGGGGGGCGCGCGGGTCCCGG + Intronic
985896392 5:2751919-2751941 CGCGAGCCGCGGGCTGGGGCCGG - Intergenic
986330703 5:6714210-6714232 CGCGGCGGGCGCGGTGGGGCCGG - Intergenic
987015102 5:13810173-13810195 CGCGGGGGCGGCGCTGGAGCTGG - Exonic
989638122 5:43557207-43557229 GGCGGGCGGCCTGCTGGGCCCGG - Intronic
992365409 5:76084558-76084580 CTTAGGCGGCGCGCGGGGGCGGG + Intronic
992365450 5:76084695-76084717 CGGGGGTGGCGGGCGGGGGCAGG + Intronic
992611267 5:78510369-78510391 CGCAGGCGGTGCTCTGGGTCCGG - Exonic
992939919 5:81751435-81751457 CGCGGGCGGCGCGGGGGGAGGGG - Intronic
993173947 5:84457842-84457864 CGCGGGTGGAGGGCTGGGGGAGG + Intergenic
997210439 5:132073891-132073913 CCAGGGCTGCGTGCTGGGGCTGG - Exonic
998135360 5:139671504-139671526 CGCGGGTGGCGGGTTGGGGCAGG + Intronic
999188819 5:149731524-149731546 CGGGCGCGGCTCGCGGGGGCTGG + Intronic
999696288 5:154190816-154190838 TGGGGGCGGCGCGGCGGGGCCGG + Exonic
1001199248 5:169700861-169700883 AGAGGGCGGCGGGCGGGGGCAGG + Intronic
1001653258 5:173329784-173329806 CGCGGGCGGGGCGCGGGGCGGGG - Intergenic
1002349985 5:178576960-178576982 CCCGGGCGCTGCGCTGGGGCCGG - Intronic
1002691464 5:181053324-181053346 CGCGGGCGGCGGGGCGGGGAGGG + Intronic
1002928836 6:1620076-1620098 CTCGGGCGGAGAGCGGGGGCGGG - Intergenic
1003645575 6:7910768-7910790 CGCGGGCATCGCGGCGGGGCTGG + Exonic
1003927137 6:10887032-10887054 AGCGGGCGGGGCTCTTGGGCGGG + Exonic
1004216756 6:13711194-13711216 AGCGGGCGGCCCGCTGGCGGGGG + Exonic
1004216978 6:13711918-13711940 CGCGAGCGGTGCGAGGGGGCGGG + Intergenic
1005825198 6:29628077-29628099 CACGGGCGGCGCGCGGCAGCGGG + Intronic
1006589159 6:35141445-35141467 CTCGAGCGGCTCGCTGCGGCCGG + Exonic
1006670677 6:35728092-35728114 CGCTGCCAGCGCGCCGGGGCTGG + Intronic
1007553597 6:42747624-42747646 CGCAGGCGGGGCGCGGGGGCAGG + Intronic
1007633103 6:43283605-43283627 CGCTGGGGGCGAGCTGGGTCTGG + Exonic
1009952632 6:70413960-70413982 CGAGGGACGCGCGCAGGGGCAGG - Intronic
1013117571 6:107114778-107114800 CACGCGCGCCGCGCGGGGGCGGG - Intronic
1014098245 6:117482799-117482821 CGGCGGCGGCGCACTGGCGCGGG + Exonic
1014272322 6:119349005-119349027 CGCGGGCGGCGTCCTGGGCGGGG - Exonic
1015149232 6:130019869-130019891 CGCGGGCCGCGGGCCGGGCCGGG + Intronic
1015251894 6:131135729-131135751 TGCGGGCGGCGCGTCTGGGCTGG - Exonic
1015910166 6:138161830-138161852 CGGCGGCTGCGGGCTGGGGCCGG - Intergenic
1016662602 6:146598907-146598929 CGGGGGCGGGGCCCTGGGGGCGG - Intergenic
1018046317 6:159969283-159969305 TGCGGGCGGCGGGCGGGCGCGGG - Exonic
1018091317 6:160348592-160348614 CGCTGGCCGAGCGCTGCGGCTGG + Exonic
1018652883 6:166006104-166006126 CGCGAGGGGCGCGCGAGGGCCGG - Intergenic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019343828 7:520276-520298 AGCGGCCGGAGCGCCGGGGCGGG - Intronic
1019381615 7:727102-727124 GGCGGGCGGCGCGCGGGCACGGG - Exonic
1019486102 7:1290053-1290075 GGCGGGGGGCGCGGTGGGGCTGG - Intergenic
1019828199 7:3301165-3301187 CGCGGGCGGCGCGTGCGGCCGGG + Intergenic
1020080266 7:5282904-5282926 CGCGGGGGGCGGGCAGAGGCGGG + Intronic
1020105347 7:5420155-5420177 GGCGGGCGCTGCGCCGGGGCGGG - Intronic
1020224884 7:6272388-6272410 CGAGGGCGCGGCGCTGGGCCGGG - Intronic
1020274312 7:6615536-6615558 CGCGGCGGGCGGGCAGGGGCGGG + Intergenic
1022094403 7:27130073-27130095 CGCGGGAGGTGGGCCGGGGCTGG - Intronic
1022096271 7:27143362-27143384 GGCGGGCGCCGCGCTGGCGCTGG + Exonic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1022106363 7:27200221-27200243 CGTGGGCGGAGCGGGGGGGCCGG - Intergenic
1022113081 7:27243249-27243271 CGCAGGCAGCGCGGCGGGGCCGG + Exonic
1022923267 7:35037194-35037216 GGCGGGCGGCGCGCCGGGCTCGG + Intronic
1026850323 7:73719573-73719595 GGGCGGCCGCGCGCTGGGGCCGG + Intronic
1028121423 7:87059721-87059743 CGCGGGCGCGGCGCGGGGGCGGG + Intergenic
1029457217 7:100677425-100677447 CGCGGGCTGCGGGGTGGGGCAGG + Intronic
1029461074 7:100694140-100694162 CGTGGGCGGCGCGCGGCGGGCGG + Intergenic
1029461078 7:100694147-100694169 GGCGCGCGGCGGGCGGGGGCCGG + Intergenic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1029708347 7:102286863-102286885 GGGGCGCGCCGCGCTGGGGCTGG + Intronic
1029735707 7:102464827-102464849 CGCGGACGGCGCGATGGCGGCGG - Exonic
1029896506 7:103989744-103989766 GCGGGGCGGCGCGCGGGGGCGGG - Intergenic
1030033526 7:105389118-105389140 CCCGGGCCGCGGGCTGGGGTGGG - Intronic
1030216002 7:107044615-107044637 CGGGGGCGGGGCGCCCGGGCGGG + Intergenic
1032174560 7:129612307-129612329 GGCGGGCGGCGCGGTGGGGCCGG + Intronic
1033253279 7:139778036-139778058 GGGGGGCGGCGGGCGGGGGCGGG + Intronic
1033253289 7:139778055-139778077 CGGGGGCGGGGCGCGGGGCCGGG + Intronic
1033477140 7:141702052-141702074 CGCAGGCGGGAGGCTGGGGCCGG - Exonic
1034197978 7:149262487-149262509 CGCGGGCTGGGCGATGGGCCGGG - Intronic
1034578932 7:152025942-152025964 CGGCGGCGGCGCGCGGGGCCTGG + Intronic
1035082995 7:156233171-156233193 CGCGGGCGGCGGGCGGGGTCGGG + Intergenic
1035581037 8:738980-739002 CGGCGGCGTCGCGCAGGGGCTGG - Intergenic
1035627257 8:1080270-1080292 CGCGGGCGGCGGGGCGGGGGTGG - Intergenic
1035751846 8:2002050-2002072 CGCGGCCGGCGCGCAGGCGGCGG - Exonic
1036784980 8:11680108-11680130 CGCGGGCTGCGCGCTCTGGGTGG - Intronic
1036786655 8:11692585-11692607 CGTGGCCCCCGCGCTGGGGCGGG + Intronic
1037305146 8:17497025-17497047 CGGGGGCGGGGCGCGGGGCCGGG - Intergenic
1038205077 8:25458237-25458259 CGGGGGCAGCGCGATGAGGCGGG - Exonic
1038319439 8:26513973-26513995 CGCGGGCGGGGCGCGGCGCCGGG - Exonic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1039050051 8:33484761-33484783 TGCAGGCGGCGCGGCGGGGCTGG - Exonic
1039454615 8:37698458-37698480 CGGGGGCGGCGGGCGGGGGGAGG - Exonic
1039554780 8:38468053-38468075 CGGGGGCGGCGGGCCGGAGCCGG - Intronic
1042040045 8:64580765-64580787 CCCGGGCTGCGCGCCGGCGCGGG + Exonic
1042155558 8:65841522-65841544 GGCGGGCGCCGCGCGGAGGCAGG - Exonic
1042591502 8:70402787-70402809 TGCAGGAGGCGCGCTGGGGCCGG - Intronic
1042877024 8:73449139-73449161 GGAGGGCGGCGGGCAGGGGCCGG + Intronic
1043388185 8:79768092-79768114 CGCGGGCGGCGGGGAGGCGCGGG + Intergenic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1045305543 8:100953117-100953139 CTCGGGCGGAGGGCTGGAGCTGG + Intronic
1045664046 8:104466949-104466971 CCCGGGCTGCGCGCAGGGGCTGG + Exonic
1046871237 8:119208160-119208182 CGCCCGCGGAGCGCTGGCGCTGG + Intronic
1047024504 8:120811588-120811610 CGCGGGCGGCGCGCAGCCCCCGG - Exonic
1048553962 8:135457583-135457605 CGCGGGCGGCGCGGTTAGGCGGG - Exonic
1048972873 8:139655025-139655047 CGGGGGGCGGGCGCTGGGGCAGG + Intronic
1049109607 8:140635143-140635165 CGGGGCCCGCGGGCTGGGGCCGG - Intronic
1049668351 8:143858808-143858830 CGCCGGCCGCGTGCTGGGCCAGG + Exonic
1049668767 8:143860407-143860429 CGCCGGCCGCGTGCTGGGCCAGG + Exonic
1049669182 8:143862009-143862031 CGCCGGCCGCGTGCTGGGCCAGG + Exonic
1049669597 8:143863611-143863633 CGCCGGCCGCGTGCTGGGCCAGG + Exonic
1049670007 8:143865204-143865226 CGCCGGCCGCGTGCTGGGCCAGG + Exonic
1049724223 8:144138063-144138085 CGCGGGCGGCGTCCCGGGCCGGG - Exonic
1049998379 9:1051717-1051739 CGCCGGCGGCGGGCTGGGCCCGG - Exonic
1051780466 9:20684020-20684042 GGAGGGCTGCGCGCGGGGGCTGG - Intronic
1053230214 9:36401295-36401317 AGCGGGGGGCGGGCTGGGGCGGG - Intronic
1054835622 9:69672427-69672449 CTCGTGACGCGCGCTGGGGCCGG + Intergenic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1057488558 9:95505893-95505915 CGCGGCCGCCGCGCTGGGGAGGG - Intronic
1058908116 9:109497979-109498001 CGCGGGCGGGGCGCCGGGTGGGG - Intronic
1059123276 9:111661545-111661567 CGCGGGTGCCGCCCCGGGGCGGG - Exonic
1059483685 9:114611446-114611468 CGCGGGAGGCGTGCTGGGCGCGG + Exonic
1061957924 9:133973230-133973252 GGCGGGCTGAGCGCTGGGCCAGG - Intronic
1061976003 9:134068224-134068246 CCCGGGGGGCGCGCGGGGGCGGG + Intronic
1062305997 9:135907414-135907436 CGCGGGCCGGGGGCGGGGGCGGG + Intergenic
1062359330 9:136180088-136180110 AGCGGGCTGCGGGCAGGGGCTGG - Intergenic
1062462019 9:136666074-136666096 GGCGGGCGGCGCGGCGGGGAGGG + Intronic
1062472442 9:136712454-136712476 CGGCGGAGGCGCGCGGGGGCGGG - Intergenic
1062575493 9:137205440-137205462 CGCGGGTGGCACGCTCGGCCGGG - Exonic
1062595190 9:137296093-137296115 TGAGGGCGGGGGGCTGGGGCCGG - Intergenic
1062596423 9:137301941-137301963 CGCGGGCCGCGGGCCGGGCCGGG + Exonic
1062596498 9:137302149-137302171 CGCGCTCGGCTCGCGGGGGCCGG + Exonic
1062614825 9:137391563-137391585 GGCGGGCGGTGGGGTGGGGCGGG - Intronic
1185504782 X:624158-624180 CGCGGTCCGCCCGCCGGGGCTGG - Intergenic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1189323449 X:40099208-40099230 CGCGGGGGGAGGGCGGGGGCAGG + Intronic
1190845027 X:54183289-54183311 CGCGGGGGGCGAGGGGGGGCGGG + Intergenic
1192033918 X:67544167-67544189 CGCTGGAGCCGGGCTGGGGCTGG - Intronic
1192146512 X:68686414-68686436 CGCGGGCGCCGCGCGGTGCCAGG - Intronic
1195485890 X:105405634-105405656 CGGGGGCAGCGCGATGAGGCGGG + Intronic
1195625108 X:106999568-106999590 CGCGCGGGGCGGGCCGGGGCTGG - Intronic
1195923295 X:110002971-110002993 GGCGGGCCGCGGGCTGGGGGTGG + Intronic
1197753456 X:129980577-129980599 CCCGGACCGCGCGCTTGGGCCGG + Intergenic
1197754448 X:129984131-129984153 GGCGGGCGGCGGGGCGGGGCCGG + Intronic
1200065885 X:153503867-153503889 TGTGGGCGGGGGGCTGGGGCGGG + Intronic
1200128686 X:153829989-153830011 CCCGGGAGGCGCGGTGCGGCGGG - Intronic
1200157025 X:153982281-153982303 CAGGGGCGGCGCGATGGGGCTGG + Exonic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic
1200310332 X:155071303-155071325 CGCGGCTGGCGCGCGGGGGCGGG - Exonic