ID: 1045232971

View in Genome Browser
Species Human (GRCh38)
Location 8:100323187-100323209
Sequence GAGTGTTATTTTAAGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045232967_1045232971 0 Left 1045232967 8:100323164-100323186 CCATAAATATTAGCTGTTACCCA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG No data
1045232966_1045232971 1 Left 1045232966 8:100323163-100323185 CCCATAAATATTAGCTGTTACCC 0: 1
1: 0
2: 3
3: 29
4: 201
Right 1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045232971 Original CRISPR GAGTGTTATTTTAAGATGAT GGG Intronic
No off target data available for this crispr