ID: 1045233054 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:100324394-100324416 |
| Sequence | TAAATCAGTAAATATTAAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045233054_1045233057 | 3 | Left | 1045233054 | 8:100324394-100324416 | CCACCTTAATATTTACTGATTTA | No data | ||
| Right | 1045233057 | 8:100324420-100324442 | ACCCAACAGGAAAACAAGTGTGG | No data | ||||
| 1045233054_1045233056 | -10 | Left | 1045233054 | 8:100324394-100324416 | CCACCTTAATATTTACTGATTTA | No data | ||
| Right | 1045233056 | 8:100324407-100324429 | TACTGATTTATAGACCCAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045233054 | Original CRISPR | TAAATCAGTAAATATTAAGG TGG (reversed) | Intronic | ||