ID: 1045233056

View in Genome Browser
Species Human (GRCh38)
Location 8:100324407-100324429
Sequence TACTGATTTATAGACCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045233054_1045233056 -10 Left 1045233054 8:100324394-100324416 CCACCTTAATATTTACTGATTTA No data
Right 1045233056 8:100324407-100324429 TACTGATTTATAGACCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045233056 Original CRISPR TACTGATTTATAGACCCAAC AGG Intronic