ID: 1045233057

View in Genome Browser
Species Human (GRCh38)
Location 8:100324420-100324442
Sequence ACCCAACAGGAAAACAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045233054_1045233057 3 Left 1045233054 8:100324394-100324416 CCACCTTAATATTTACTGATTTA No data
Right 1045233057 8:100324420-100324442 ACCCAACAGGAAAACAAGTGTGG No data
1045233055_1045233057 0 Left 1045233055 8:100324397-100324419 CCTTAATATTTACTGATTTATAG No data
Right 1045233057 8:100324420-100324442 ACCCAACAGGAAAACAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045233057 Original CRISPR ACCCAACAGGAAAACAAGTG TGG Intronic