ID: 1045233617

View in Genome Browser
Species Human (GRCh38)
Location 8:100329959-100329981
Sequence ATGTTCAAGTAGAGCTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045233616_1045233617 6 Left 1045233616 8:100329930-100329952 CCAAAATCATGAACTATCTATTA 0: 1
1: 0
2: 45
3: 60
4: 324
Right 1045233617 8:100329959-100329981 ATGTTCAAGTAGAGCTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045233617 Original CRISPR ATGTTCAAGTAGAGCTTAGA TGG Intronic
No off target data available for this crispr