ID: 1045251685

View in Genome Browser
Species Human (GRCh38)
Location 8:100487889-100487911
Sequence GGGTAGGAGTTGAACCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045251685_1045251693 9 Left 1045251685 8:100487889-100487911 CCCCTGAGGTTCAACTCCTACCC No data
Right 1045251693 8:100487921-100487943 CCTCCAAGATTCTGTGACCTGGG No data
1045251685_1045251691 8 Left 1045251685 8:100487889-100487911 CCCCTGAGGTTCAACTCCTACCC No data
Right 1045251691 8:100487920-100487942 TCCTCCAAGATTCTGTGACCTGG No data
1045251685_1045251694 10 Left 1045251685 8:100487889-100487911 CCCCTGAGGTTCAACTCCTACCC No data
Right 1045251694 8:100487922-100487944 CTCCAAGATTCTGTGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045251685 Original CRISPR GGGTAGGAGTTGAACCTCAG GGG (reversed) Intergenic
No off target data available for this crispr