ID: 1045252415

View in Genome Browser
Species Human (GRCh38)
Location 8:100492916-100492938
Sequence TTTTTTCAGGACAAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045252415_1045252420 10 Left 1045252415 8:100492916-100492938 CCCCAAGGCTTGTCCTGAAAAAA No data
Right 1045252420 8:100492949-100492971 TTCTTCTAAGGTCCCGAGCGTGG No data
1045252415_1045252419 -2 Left 1045252415 8:100492916-100492938 CCCCAAGGCTTGTCCTGAAAAAA No data
Right 1045252419 8:100492937-100492959 AAGAACATCATCTTCTTCTAAGG No data
1045252415_1045252421 11 Left 1045252415 8:100492916-100492938 CCCCAAGGCTTGTCCTGAAAAAA No data
Right 1045252421 8:100492950-100492972 TCTTCTAAGGTCCCGAGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045252415 Original CRISPR TTTTTTCAGGACAAGCCTTG GGG (reversed) Intergenic
No off target data available for this crispr