ID: 1045252419

View in Genome Browser
Species Human (GRCh38)
Location 8:100492937-100492959
Sequence AAGAACATCATCTTCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045252415_1045252419 -2 Left 1045252415 8:100492916-100492938 CCCCAAGGCTTGTCCTGAAAAAA No data
Right 1045252419 8:100492937-100492959 AAGAACATCATCTTCTTCTAAGG No data
1045252417_1045252419 -4 Left 1045252417 8:100492918-100492940 CCAAGGCTTGTCCTGAAAAAAGA No data
Right 1045252419 8:100492937-100492959 AAGAACATCATCTTCTTCTAAGG No data
1045252416_1045252419 -3 Left 1045252416 8:100492917-100492939 CCCAAGGCTTGTCCTGAAAAAAG No data
Right 1045252419 8:100492937-100492959 AAGAACATCATCTTCTTCTAAGG No data
1045252411_1045252419 28 Left 1045252411 8:100492886-100492908 CCAAGAGAAATGAGGCACAGGGG No data
Right 1045252419 8:100492937-100492959 AAGAACATCATCTTCTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045252419 Original CRISPR AAGAACATCATCTTCTTCTA AGG Intergenic
No off target data available for this crispr