ID: 1045252421

View in Genome Browser
Species Human (GRCh38)
Location 8:100492950-100492972
Sequence TCTTCTAAGGTCCCGAGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045252417_1045252421 9 Left 1045252417 8:100492918-100492940 CCAAGGCTTGTCCTGAAAAAAGA No data
Right 1045252421 8:100492950-100492972 TCTTCTAAGGTCCCGAGCGTGGG No data
1045252416_1045252421 10 Left 1045252416 8:100492917-100492939 CCCAAGGCTTGTCCTGAAAAAAG No data
Right 1045252421 8:100492950-100492972 TCTTCTAAGGTCCCGAGCGTGGG No data
1045252415_1045252421 11 Left 1045252415 8:100492916-100492938 CCCCAAGGCTTGTCCTGAAAAAA No data
Right 1045252421 8:100492950-100492972 TCTTCTAAGGTCCCGAGCGTGGG No data
1045252418_1045252421 -2 Left 1045252418 8:100492929-100492951 CCTGAAAAAAGAACATCATCTTC No data
Right 1045252421 8:100492950-100492972 TCTTCTAAGGTCCCGAGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045252421 Original CRISPR TCTTCTAAGGTCCCGAGCGT GGG Intergenic
No off target data available for this crispr