ID: 1045252956

View in Genome Browser
Species Human (GRCh38)
Location 8:100496566-100496588
Sequence CCCAAGGCCATGGCCACGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045252956_1045252964 30 Left 1045252956 8:100496566-100496588 CCCACCGTGGCCATGGCCTTGGG No data
Right 1045252964 8:100496619-100496641 CTCCTACTTTCCCAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045252956 Original CRISPR CCCAAGGCCATGGCCACGGT GGG (reversed) Intergenic
No off target data available for this crispr