ID: 1045254231

View in Genome Browser
Species Human (GRCh38)
Location 8:100506243-100506265
Sequence TGCCCTGGCAATGGTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045254227_1045254231 -7 Left 1045254227 8:100506227-100506249 CCAAAATTAAAGCCAGTGCCCTG No data
Right 1045254231 8:100506243-100506265 TGCCCTGGCAATGGTCTGCAAGG No data
1045254226_1045254231 -6 Left 1045254226 8:100506226-100506248 CCCAAAATTAAAGCCAGTGCCCT No data
Right 1045254231 8:100506243-100506265 TGCCCTGGCAATGGTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045254231 Original CRISPR TGCCCTGGCAATGGTCTGCA AGG Intergenic
No off target data available for this crispr