ID: 1045256361

View in Genome Browser
Species Human (GRCh38)
Location 8:100526979-100527001
Sequence CTTCACACGTATAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045256356_1045256361 22 Left 1045256356 8:100526934-100526956 CCGAGAATACTGGGAAGAGGCTA 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG No data
1045256354_1045256361 26 Left 1045256354 8:100526930-100526952 CCTACCGAGAATACTGGGAAGAG 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045256361 Original CRISPR CTTCACACGTATAATGTGGA AGG Intronic
No off target data available for this crispr