ID: 1045257134

View in Genome Browser
Species Human (GRCh38)
Location 8:100535713-100535735
Sequence ATGGATACACACAGCTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045257134_1045257141 20 Left 1045257134 8:100535713-100535735 CCAGGGTAGCTGTGTGTATCCAT 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1045257141 8:100535756-100535778 ATAGTAGTATTCCGTGGCATGGG No data
1045257134_1045257140 19 Left 1045257134 8:100535713-100535735 CCAGGGTAGCTGTGTGTATCCAT 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1045257140 8:100535755-100535777 CATAGTAGTATTCCGTGGCATGG No data
1045257134_1045257138 14 Left 1045257134 8:100535713-100535735 CCAGGGTAGCTGTGTGTATCCAT 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1045257138 8:100535750-100535772 TTATCCATAGTAGTATTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045257134 Original CRISPR ATGGATACACACAGCTACCC TGG (reversed) Intronic
900593570 1:3470397-3470419 ATGCACACACACTGCTGCCCAGG - Intronic
901708505 1:11095359-11095381 ACGGATAGACAGAGCAACCCAGG - Intronic
912445799 1:109735298-109735320 ATGCATAGTCCCAGCTACCCAGG - Exonic
915675093 1:157522415-157522437 TTGCAGACACACAGCTAGCCAGG - Intronic
918048551 1:180955454-180955476 GTGGAAACAAACAGCTGCCCAGG - Intergenic
918161947 1:181909547-181909569 ATGGACTCCCACAGCTACCGGGG + Intergenic
918466328 1:184824903-184824925 ATTGACACACATAGCTACCTTGG + Intronic
919205800 1:194420638-194420660 AAGGGTGCACACACCTACCCAGG + Intergenic
920179721 1:204124958-204124980 ACGCATACACACAGCACCCCTGG - Intronic
920652191 1:207846343-207846365 ATGGATACCCAAAGCTACCGAGG + Intergenic
922749293 1:228063202-228063224 ATGGGAGCACAGAGCTACCCAGG + Intergenic
922989863 1:229897323-229897345 ATGGAGAGACACATCTACCTCGG - Intergenic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
1064227702 10:13501867-13501889 ATGTTTACACACACATACCCTGG - Intronic
1067677719 10:48399453-48399475 ATGGATAGTCACAACTCCCCAGG - Intronic
1068875606 10:61992644-61992666 ATGGAAACACAGATCTTCCCAGG - Intronic
1070787411 10:79170016-79170038 ATGGAGACACAGTGCTTCCCAGG + Intronic
1071345309 10:84686464-84686486 ATCTATAGACACAGCTACCCTGG + Intergenic
1075488585 10:122847478-122847500 ATGGATACCCACTCCCACCCTGG + Intronic
1076466929 10:130689322-130689344 ATGGATCCCCACAGGCACCCAGG + Intergenic
1077155998 11:1091390-1091412 ATGCCTAGACACAGATACCCAGG + Intergenic
1077156007 11:1091584-1091606 ATGCATAGACACAGACACCCAGG + Intergenic
1078326508 11:10385916-10385938 ATGGATTCACAGAGCTGCCAGGG - Intronic
1079474701 11:20817361-20817383 CTGGATACACACAACTTCCCAGG - Intronic
1080188234 11:29518084-29518106 ATGTATACACACATCTACTGTGG - Intergenic
1084755796 11:71237889-71237911 ATGAACACACACCACTACCCAGG + Intronic
1085061489 11:73451201-73451223 ATAGATAGACAAAGCTGCCCAGG - Intronic
1090636105 11:128691546-128691568 ATGCATAGACACAGGCACCCCGG - Intronic
1091452338 12:580933-580955 ATGAATACACACAGACACACAGG - Intronic
1095838047 12:46660078-46660100 ATGGAGACAGGCAGATACCCCGG - Intergenic
1096048909 12:48588812-48588834 CTGGAAACACACAGCCTCCCAGG + Intergenic
1104734079 12:131125459-131125481 ATGTAGACACATAGCTACCCTGG - Intronic
1106953748 13:34912973-34912995 ATGGAAAGACACAGTTACCTAGG + Intergenic
1108831168 13:54480378-54480400 ATGGATGCACACATATACACAGG - Intergenic
1108923561 13:55707876-55707898 ATGCATACACATAGATACACAGG + Intergenic
1109597021 13:64569936-64569958 ATGGATACCAACACCTACTCTGG + Intergenic
1110658589 13:78030741-78030763 AAGAATAAACACAGCAACCCTGG + Intergenic
1112261485 13:97881917-97881939 ATGTATCCACACACGTACCCAGG + Intergenic
1114455368 14:22850234-22850256 ATGAAAACGCCCAGCTACCCAGG - Intergenic
1115780457 14:36762964-36762986 ATGTATCCACATAGCTACCAGGG - Intronic
1116287158 14:42988008-42988030 ATGGAAACACTTGGCTACCCAGG + Intergenic
1117199504 14:53373759-53373781 ATGAATACACAAAGCTTCCCGGG - Intergenic
1117864112 14:60127476-60127498 GTGAATGCACACAGCTACCTTGG - Intronic
1118036904 14:61877710-61877732 CTGAGTACACACAGCTCCCCAGG - Intergenic
1119748119 14:77058953-77058975 ATAGATGCACAGAGCTCCCCGGG + Intergenic
1122199321 14:100112847-100112869 GTGGATACAAACTGCTCCCCTGG - Intronic
1122276907 14:100595476-100595498 ATTGATACACACAGCAACGTGGG - Intergenic
1125071849 15:35564264-35564286 GTGGATACACAAAGAGACCCTGG - Intergenic
1128341429 15:66825165-66825187 GAGGAAGCACACAGCTACCCAGG - Intergenic
1129537943 15:76329616-76329638 ATGGATGAACACAGCTATGCCGG - Intergenic
1130654872 15:85785633-85785655 ATGTGGACACACACCTACCCTGG - Intronic
1133161384 16:3914337-3914359 ATGTATAGTCACAGCTACTCAGG - Intergenic
1133173076 16:3993679-3993701 GTGGAAACACACAGAAACCCGGG + Intronic
1134029416 16:10979760-10979782 GTGCATACACACAGCAACCTTGG + Intronic
1134766099 16:16759359-16759381 ATGGATACACTCAGCTGCATAGG - Intergenic
1134979947 16:18599855-18599877 ATGGATACACTCAGCTGCATAGG + Intergenic
1137514168 16:49128473-49128495 ATGGATACAAAATGGTACCCAGG - Intergenic
1141035205 16:80620290-80620312 CTGCAAACACACAGCTGCCCAGG + Intronic
1141322252 16:83022319-83022341 ATGGAGAGACCCAGCTATCCTGG - Intronic
1141340677 16:83201100-83201122 ATGAACAGGCACAGCTACCCTGG - Intronic
1142407015 16:89895935-89895957 ATGGCCACACACAGCAACCACGG - Intronic
1143738287 17:8930706-8930728 ATTGATACACACAACAACCTGGG + Intronic
1144037507 17:11380890-11380912 GTGAAGACACTCAGCTACCCAGG - Intronic
1144838760 17:18172735-18172757 TTGGATACACAGAGATACCAGGG - Intronic
1146591784 17:34133650-34133672 AAGGAAACCCACAGCTTCCCTGG + Intronic
1147341547 17:39755685-39755707 AAAGAGACACACAGCTCCCCAGG + Intergenic
1148742294 17:49899595-49899617 ATGGATACATACAGAAAACCAGG + Intergenic
1149589144 17:57815586-57815608 ATGGATGCCCACACATACCCTGG + Intergenic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1157614892 18:48980623-48980645 ATGGAGACTCACAGCCAGCCTGG + Intergenic
1159688090 18:71448735-71448757 AAGGAGAGACACAGCTAACCTGG - Intergenic
1159857275 18:73604110-73604132 ATGGATCCACTCAGCTCTCCAGG + Intergenic
1159941231 18:74410644-74410666 ATGTAGACACACACCTGCCCTGG + Intergenic
1160548181 18:79675891-79675913 ATGTTCACACACAGATACCCAGG + Intergenic
1160842507 19:1152541-1152563 CTGGATCCTCACAGCTGCCCCGG - Intronic
1160925683 19:1544095-1544117 GTGGATACACGAATCTACCCAGG + Intergenic
1161191375 19:2958889-2958911 ATGGATACACAGACTTACCCAGG - Intergenic
1161726069 19:5929772-5929794 AAGGATACACACAGCGAGCCTGG + Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162532090 19:11241945-11241967 AAGGACACACACAGACACCCTGG - Intronic
1164399594 19:27893493-27893515 CAGGATACACACAGCTATGCAGG - Intergenic
1164870518 19:31639730-31639752 ATGCATGCACACAGCTTCACAGG - Intergenic
1165922093 19:39305534-39305556 TTGGATATCCACAGCTAGCCTGG - Intergenic
925679008 2:6397168-6397190 TTGGATACACAGAGATACCAGGG - Intergenic
932835393 2:75031188-75031210 ATGGCTCCACACAGCCACCTCGG + Intergenic
933290784 2:80436211-80436233 AGGGACAGACACTGCTACCCAGG + Intronic
937482127 2:122272755-122272777 ATGGAGACACCCACCTCCCCAGG + Intergenic
938378575 2:130824082-130824104 ATGGCCACACACAGCCACACTGG + Intergenic
939570271 2:143832457-143832479 ATGCATACACCCAGCTGCCTAGG - Intergenic
941288147 2:163640964-163640986 CTGGAAACCCACAGCTAGCCAGG + Intronic
1168794795 20:604411-604433 ATGGATCCTCACAGCTCTCCAGG + Exonic
1169965958 20:11217591-11217613 ATGGATACAGTCAGCCACCAGGG + Intergenic
1170758255 20:19224178-19224200 ATGAATACACAAACCTACACAGG - Intronic
1171280624 20:23893563-23893585 ATGGATACCAACACCTACTCTGG + Intergenic
1172677438 20:36683750-36683772 TTGGATACTGACAGCTACCAAGG - Intronic
1174088080 20:48024552-48024574 ATTCATACACACATCTACCTTGG - Intergenic
1174341780 20:49901643-49901665 CTGGAGACGCACACCTACCCTGG - Intergenic
1174607265 20:51769751-51769773 ATGTATAACCCCAGCTACCCGGG - Intergenic
1175571722 20:60028097-60028119 ATGATTACACAGACCTACCCAGG - Intronic
1177257800 21:18689041-18689063 ATTTATACACACAGAAACCCTGG + Intergenic
1177360219 21:20058799-20058821 CTGGATACAGACAGGTACACAGG + Intergenic
1179524972 21:41970060-41970082 ATGCATGCCCACAGCTACCCTGG + Intergenic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1181711493 22:24694563-24694585 ATGGAGTCTTACAGCTACCCTGG + Intergenic
1182749104 22:32627493-32627515 ATGCAGACACACATCTACCTGGG + Intronic
1183178138 22:36239189-36239211 ATGGGTTCACAAAGCTCCCCGGG - Intronic
1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG + Intergenic
955702784 3:61698495-61698517 ATTGACACACACAGCTACAGTGG - Intronic
962262582 3:133923138-133923160 GTGGATACATGCAGCTACACAGG + Intergenic
962320615 3:134387549-134387571 AAGGATACACTGAGCTTCCCAGG - Intergenic
962433519 3:135343210-135343232 GTGGATACACAAACCTACACAGG + Intergenic
963779501 3:149473147-149473169 ATGGATACCCCCAAATACCCTGG + Intergenic
964166751 3:153716112-153716134 AGAGGTACACACAGCTACTCAGG + Intergenic
965239594 3:166177816-166177838 ATGGACACAGACAGCTACAAGGG + Intergenic
966728404 3:183129943-183129965 ATGGATACAGACAGGTACAGAGG + Intronic
969210536 4:5683814-5683836 AGGAACACACACAGCTGCCCAGG + Intronic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
975286511 4:72627939-72627961 ATGGATGTACACAGGGACCCAGG - Intergenic
976377876 4:84365459-84365481 GTGCATTCACCCAGCTACCCTGG + Intergenic
980935151 4:139219269-139219291 ATAGATAGACCCAGCTACTCTGG - Intergenic
982316843 4:154040691-154040713 ATGGATACCCATAACTGCCCTGG - Intergenic
984234728 4:177142311-177142333 ATGGAAACACCTAGATACCCAGG + Intergenic
987171106 5:15259023-15259045 AGGGATTCACACTGCTCCCCTGG - Intergenic
987531811 5:19130740-19130762 ATGGAAACACCCAGATGCCCAGG - Intergenic
987957289 5:24756541-24756563 ATGTATACACAAACATACCCTGG + Intergenic
988702606 5:33690130-33690152 ATGGATGCACACACCTGCACTGG - Intronic
996011659 5:118487322-118487344 ATAGAAACACACAGATAACCAGG - Intergenic
997883976 5:137614525-137614547 ATGGACACACACAGAAACACAGG - Intergenic
998880020 5:146636223-146636245 AAGGATATATACAGGTACCCCGG - Intronic
999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG + Intronic
1001351602 5:170972817-170972839 ATAGAAACAGACACCTACCCTGG - Intronic
1002686824 5:181018931-181018953 ATGTCTACACTCAGCTAACCAGG - Intergenic
1002693430 5:181067113-181067135 ATGGATACACAAAGATAGCAGGG + Intergenic
1005277129 6:24231215-24231237 AGGGAGACACACAGCAAACCTGG - Intronic
1014422238 6:121260609-121260631 ATGGAAAAGCACAGCTTCCCAGG - Intronic
1015710739 6:136137128-136137150 ATGTATAATCCCAGCTACCCTGG + Intronic
1017483115 6:154877714-154877736 ATGGATATACACAGCCAAACTGG - Intronic
1022748713 7:33201331-33201353 ATGGAAATAAACAGATACCCAGG - Intronic
1024288409 7:47780722-47780744 ATTGATCCACACAGCCACCTGGG - Intronic
1024347904 7:48331792-48331814 ATGAATACACAAACCTACACAGG - Intronic
1025087676 7:56036100-56036122 ATGGATAATCCCAGCTACTCGGG + Intronic
1032076501 7:128838550-128838572 CTGGACACACACAGCTGCCCCGG - Intronic
1032785896 7:135199016-135199038 ATGAATGCAAACAGCTACTCAGG + Intronic
1035126837 7:156614319-156614341 ATGGAAGTACACAGCTATCCTGG + Intergenic
1036345213 8:7956671-7956693 ATATACACACACAGCTATCCTGG - Intergenic
1036862345 8:12363683-12363705 ATATACACACACAGCTATCCTGG - Intergenic
1039911705 8:41831865-41831887 ATGGATTCACACAGCAACACGGG + Intronic
1041147619 8:54894449-54894471 ATGGATCCTCACTGCTATCCTGG + Intergenic
1043092875 8:75927453-75927475 ATGGACACACACAGTTGCACTGG + Intergenic
1044299153 8:90563760-90563782 ATGGATACACACTACTTGCCAGG - Intergenic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1046642305 8:116745792-116745814 ATGGTGGCACACAGCTACTCGGG + Intronic
1047457413 8:125028623-125028645 TTCGGTACACAAAGCTACCCAGG - Exonic
1050575928 9:6995325-6995347 ATGGACACACACAGACACACAGG + Intronic
1053370162 9:37554121-37554143 ATAGATACACAAAGTTACACAGG - Intronic
1057759777 9:97862870-97862892 TTGGATCCTCACAGCTCCCCTGG + Intergenic
1059074205 9:111174074-111174096 ATTGATACACACAGCTACATGGG + Intergenic
1059482301 9:114600844-114600866 ATGGAAACACCTAGATACCCAGG - Intergenic
1062090932 9:134678509-134678531 AGGGATGCAGACAGCTTCCCGGG - Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1189912204 X:45821648-45821670 ATGGTGGCACACAGCTACTCGGG + Intergenic
1191223199 X:58013884-58013906 ATGGATACTAACACCTACTCTGG + Intergenic
1192438394 X:71156650-71156672 ATGCACACACACCTCTACCCAGG + Intronic
1192811992 X:74555229-74555251 ATGCATACTCACAGTTTCCCTGG + Intergenic
1195563385 X:106311700-106311722 ATGGTTACACACATCCACCCAGG + Intergenic
1195616314 X:106915167-106915189 ATTGATACACACAGCTACATGGG - Intronic
1195785782 X:108520951-108520973 ATGCACACACATAGATACCCTGG - Intronic
1201519262 Y:14854378-14854400 GTGTATAAACACAGCTACCCTGG - Intergenic