ID: 1045259481

View in Genome Browser
Species Human (GRCh38)
Location 8:100559629-100559651
Sequence GACCTCCAGTGCTACAGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 178}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045259471_1045259481 4 Left 1045259471 8:100559602-100559624 CCCTCAGGGCCCCGGCCAGGCCT 0: 1
1: 0
2: 4
3: 46
4: 374
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259468_1045259481 10 Left 1045259468 8:100559596-100559618 CCTCGCCCCTCAGGGCCCCGGCC 0: 1
1: 0
2: 10
3: 92
4: 744
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259462_1045259481 19 Left 1045259462 8:100559587-100559609 CCCGGGCACCCTCGCCCCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259472_1045259481 3 Left 1045259472 8:100559603-100559625 CCTCAGGGCCCCGGCCAGGCCTA 0: 1
1: 0
2: 3
3: 40
4: 427
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259475_1045259481 -6 Left 1045259475 8:100559612-100559634 CCCGGCCAGGCCTACTGGACCTC 0: 1
1: 0
2: 0
3: 23
4: 238
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259470_1045259481 5 Left 1045259470 8:100559601-100559623 CCCCTCAGGGCCCCGGCCAGGCC 0: 1
1: 0
2: 6
3: 66
4: 455
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259464_1045259481 18 Left 1045259464 8:100559588-100559610 CCGGGCACCCTCGCCCCTCAGGG 0: 1
1: 0
2: 4
3: 54
4: 425
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259476_1045259481 -7 Left 1045259476 8:100559613-100559635 CCGGCCAGGCCTACTGGACCTCC 0: 1
1: 0
2: 1
3: 24
4: 219
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259467_1045259481 11 Left 1045259467 8:100559595-100559617 CCCTCGCCCCTCAGGGCCCCGGC 0: 1
1: 0
2: 2
3: 33
4: 328
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178
1045259474_1045259481 -5 Left 1045259474 8:100559611-100559633 CCCCGGCCAGGCCTACTGGACCT 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG 0: 1
1: 0
2: 2
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045259481 Original CRISPR GACCTCCAGTGCTACAGGGA CGG Intronic
900365492 1:2310475-2310497 CACATCCAGTGCTACAAGCAGGG - Intergenic
900396210 1:2454211-2454233 CACCTCCAGTGCTGCAGGGCAGG - Intronic
900800797 1:4735845-4735867 GAGCTGCAGTGACACAGGGAAGG - Intronic
901099148 1:6705919-6705941 TACCTCCAGTGCTATAGGGAGGG - Intergenic
901822848 1:11841326-11841348 GGCCTCCTGTGCCGCAGGGAGGG + Exonic
902036806 1:13463962-13463984 GCCCTCCAGTGCTTCAAGGGAGG - Intergenic
902064230 1:13671002-13671024 GCCCTCCCGTGCTTGAGGGATGG - Intergenic
902303797 1:15521957-15521979 GACCTACAGTGCCACTGAGAAGG + Intronic
904754051 1:32758408-32758430 AACCTCCAGGTCTACAGGCAGGG - Intronic
906769912 1:48474711-48474733 GACTTGCAGTTCCACAGGGAGGG - Intergenic
908172290 1:61517386-61517408 TTCCTCCAGTGGTATAGGGAGGG + Intergenic
910207848 1:84765500-84765522 GAGCTCCAGAGCCACAGTGAGGG + Intergenic
912634961 1:111283317-111283339 GACCTCCATGGCTCCTGGGAGGG + Intergenic
912638113 1:111318017-111318039 GACCTCCATGGCTCCTGGGAGGG + Exonic
913983929 1:143548379-143548401 GACATTTAGGGCTACAGGGAGGG - Intergenic
915028846 1:152858789-152858811 GACTTCCTGTGTTACAGGGGAGG - Intergenic
916198468 1:162247450-162247472 GGCCTACAGTGCTCCAGGAAAGG - Intronic
920575526 1:207057063-207057085 GACTTCAACTGCTCCAGGGATGG + Intronic
922507879 1:226136999-226137021 GGCCTCCAGTGGTACAGAGCAGG + Intergenic
922605925 1:226889955-226889977 GGGCTCCTGTGCTACAGGGCAGG + Intronic
1062922553 10:1291229-1291251 GGCCTCCAGTGCCACAGAGGTGG + Intronic
1065463808 10:25997992-25998014 CACCTACAGTGCAAAAGGGAAGG - Intronic
1066447339 10:35495675-35495697 CACCTCCTGTGCTGCAGGAAGGG - Intronic
1067077738 10:43197684-43197706 GACCTCCAATCCCACAGGGGTGG + Intronic
1070797668 10:79226280-79226302 GACCTGCAGAGATGCAGGGATGG - Intronic
1074414004 10:113251265-113251287 TCCCTCCAGAGCTACAGGGCAGG + Intergenic
1075745359 10:124723750-124723772 GAACCCCAGTGGGACAGGGAGGG + Intronic
1076611167 10:131726765-131726787 TGCCTTCAGTGCTGCAGGGAGGG - Intergenic
1077370922 11:2181224-2181246 GACCTGCCATGCTTCAGGGAGGG + Intergenic
1077460312 11:2705776-2705798 AACCACCAGAGCGACAGGGATGG - Intronic
1078655989 11:13239713-13239735 GATCTCCAGTTCTACAGATAAGG + Intergenic
1080272302 11:30463462-30463484 AACCTCCAGGGCTAAAGGGGTGG - Intronic
1080981853 11:37417101-37417123 GATTTCCTGTGCTTCAGGGAGGG - Intergenic
1081157933 11:39717195-39717217 GACTTACAGTTCTACACGGATGG - Intergenic
1082058599 11:47841590-47841612 GACAGCCAGTGTTACAAGGAAGG + Intronic
1083671639 11:64303415-64303437 CATCTCCTGTGCTCCAGGGAAGG + Intronic
1083958449 11:66000247-66000269 GCCCTCCAGGGCTGCAGGGGTGG + Intronic
1084219361 11:67667871-67667893 GACCTCCCCTACTCCAGGGAGGG + Intronic
1087732897 11:101798518-101798540 GATCCTCAGTGCTACTGGGAGGG + Intronic
1088101433 11:106160378-106160400 GTGCTACAGTGCTACAGGTAGGG - Intergenic
1089435811 11:118465328-118465350 GACCCCCAGTTCTTTAGGGATGG + Intronic
1093011588 12:14112851-14112873 GAACTCCTGTGGTAAAGGGAAGG + Intergenic
1101490436 12:105204886-105204908 GACCTCCAGTGTTACATTGACGG - Intronic
1101738652 12:107482642-107482664 GGCCGCCAGTGCTGCAGGAAGGG - Intronic
1102703660 12:114862497-114862519 CACCTATAGTGCTACAGGCATGG + Intergenic
1103036088 12:117657668-117657690 GCCCTCCAGAGCTGCAGGGCTGG - Intronic
1103262191 12:119597023-119597045 GACTTCCAGTGCAACAGGAAGGG - Intronic
1104279492 12:127361724-127361746 GACCCTCAGTTCTACAGGGATGG - Intergenic
1104435705 12:128754818-128754840 GACTTACAGTTCTGCAGGGATGG + Intergenic
1104847072 12:131852019-131852041 GAGCCTCAGTGCTACAGGCAGGG + Intergenic
1109220530 13:59636755-59636777 GATCCCCTGAGCTACAGGGATGG - Intergenic
1110914321 13:81002456-81002478 AACCTCCAGTGCTGGAGGTAAGG - Intergenic
1111641908 13:90979987-90980009 ATCCTGCAGAGCTACAGGGATGG - Intergenic
1111814483 13:93133545-93133567 GACCTCCAGTGTTAGAGGTGGGG + Intergenic
1114753923 14:25237048-25237070 GACCTTCAGTTCTTCAGGGATGG + Intergenic
1118336627 14:64858728-64858750 GACGTCCTGGGCTACAGGAAAGG + Intronic
1119772285 14:77227722-77227744 AACCTCTAGTGCTACAGAGGTGG + Intronic
1120567989 14:86082989-86083011 GACCTACAGTTCTGCATGGATGG + Intergenic
1122026458 14:98881058-98881080 GACCCCCAGTGTTAGAGGTAGGG + Intergenic
1124664801 15:31583161-31583183 CTCCTGCAGTGCTGCAGGGATGG - Intronic
1126416697 15:48425203-48425225 TACCTCCTGTGCTGGAGGGAAGG - Intronic
1128108841 15:65063546-65063568 GCCCTTCAGTGCTACAGTGGAGG - Intronic
1129335483 15:74849928-74849950 GGCCTCCAGTGGTACAGGGATGG + Intronic
1130986766 15:88849474-88849496 GAACTCCAGTGCTTCCTGGAAGG - Exonic
1131525274 15:93147618-93147640 GACCTGGAGTGCTACAGGACTGG - Intergenic
1132467744 16:85309-85331 GACATCCTGTGCTGCAGGGAGGG - Intronic
1135427037 16:22347168-22347190 GACCTCCAGGGCTGCAGCCAAGG - Exonic
1136026799 16:27473865-27473887 TCCCTCCAGTGCTCTAGGGAAGG - Intronic
1136540323 16:30924695-30924717 GCCCTCCAGCGCTCCAGGGGAGG - Exonic
1137032042 16:35532698-35532720 GACCTCCAGCCCTCCAGGGATGG + Intergenic
1137806333 16:51309495-51309517 GACCCACAGTGCCACAGGGCTGG - Intergenic
1140240031 16:73192144-73192166 GACTTCCAGAGCTGGAGGGAAGG - Intergenic
1144588627 17:16504835-16504857 GGAATCCAGTGCTACAGGGGAGG - Intergenic
1147228132 17:38996643-38996665 GACCCCCAGGGCCACAGGGTAGG - Intergenic
1147656908 17:42096320-42096342 GACCTCCAGAGTCACAGGTATGG + Intergenic
1150069055 17:62137235-62137257 GCCCTGCACTGCTACAGGAAGGG - Intergenic
1153675089 18:7450119-7450141 GATCCCCACTGCTTCAGGGAAGG + Intergenic
1159246212 18:65808623-65808645 GTCCTCAACAGCTACAGGGAAGG + Intronic
1159306253 18:66646854-66646876 GATCTCCAGTGCTAAGGGGCTGG - Intergenic
1159886461 18:73912129-73912151 GACCACCCTGGCTACAGGGAAGG - Intergenic
1160628764 18:80231006-80231028 GACCTAAAGAGCTACAGTGATGG + Intronic
1161488941 19:4551155-4551177 GACATCCAGTTAAACAGGGATGG - Intronic
1163044396 19:14628739-14628761 GACAGCCAGTGTTACAAGGAAGG + Intronic
1163349980 19:16770420-16770442 GACCTACAGTTCTGCAGGGCTGG - Intronic
1163669045 19:18617073-18617095 CACCTCCAGGGCTTCAGGGTGGG - Exonic
1164189541 19:22901708-22901730 GTCCGCCCCTGCTACAGGGAAGG - Intergenic
925574724 2:5349087-5349109 GCCCTCCATTGCTGCAGAGAGGG + Intergenic
926684961 2:15691250-15691272 GACCTCCAGATCTCCAGGGAGGG + Intronic
927418277 2:22902751-22902773 GATATCCAGTGCTAGAGGGAAGG - Intergenic
927557702 2:24047635-24047657 GAGCTCAAGTGCTTAAGGGAGGG - Intronic
927700921 2:25268464-25268486 GCCTTGCAGAGCTACAGGGAGGG + Intronic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
937438277 2:121896903-121896925 GTCCTTCAGTGCCTCAGGGAAGG - Intergenic
938822693 2:134975485-134975507 GCCCTCCAGTGGTACACGCAGGG + Intronic
939926941 2:148186321-148186343 GACTTACAGTGCTACATGGCTGG - Intronic
940647383 2:156405857-156405879 GACACCCAGTGCGACAGGCAGGG + Intergenic
941318431 2:164024358-164024380 GACCCTCAGTTCTTCAGGGATGG - Intergenic
943081831 2:183265505-183265527 GACCTCAATTTCTACATGGAAGG - Intergenic
944382150 2:199123592-199123614 GACCCCCAGTTCTTTAGGGATGG - Intergenic
946114184 2:217447151-217447173 GACCTCCAGAGATGCTGGGATGG - Intronic
947205903 2:227660998-227661020 GACCTACAGTCATACAGGGAAGG + Intergenic
948767484 2:240230768-240230790 GACATCCAGGGCTGCATGGAAGG + Intergenic
1169391243 20:5192993-5193015 GGCCTCCTGAGCTAGAGGGAAGG - Exonic
1175262278 20:57682095-57682117 CATCTCCAGTGGCACAGGGAAGG + Intronic
1179478208 21:41661201-41661223 GATCTCCAGTGCAACAGAGAAGG - Intergenic
1180171407 21:46060591-46060613 GACCTTCAGTTCTACAGCTAGGG + Intergenic
1182823856 22:33245057-33245079 GACCCTCAGTTCTCCAGGGATGG - Intronic
1183282829 22:36941864-36941886 GAGCTGCAGTCCTCCAGGGAAGG - Intergenic
1184522523 22:45003554-45003576 GGCCTGCAGAGCCACAGGGATGG - Intronic
1184597658 22:45524134-45524156 GACCTCCAGTCCCCCAGGGAAGG + Intronic
1184637967 22:45850407-45850429 AACCTCCATTGCTACAGGCAGGG + Intergenic
1185067438 22:48639237-48639259 GACCCACAGTGCCACTGGGAAGG - Intronic
949488766 3:4567281-4567303 GATCACTAGTGCTACAGGAATGG - Intronic
952132633 3:30383292-30383314 GTCCTGCAGAGCCACAGGGATGG - Intergenic
953454108 3:43028782-43028804 GGCCTCCAGGGCCACAGGGCAGG - Intronic
955353805 3:58214009-58214031 GTCCTCCAGTATTACATGGAGGG - Intronic
955519779 3:59763879-59763901 CGCCTCCAGTGCTAAAGGGAAGG - Intronic
961496873 3:127299576-127299598 AACCTCCATTGCTAGAGGAAGGG + Intergenic
961657328 3:128450375-128450397 GCCCTCCACTGAGACAGGGAAGG - Intergenic
962257848 3:133884607-133884629 GAAGTCCAGTGAGACAGGGAGGG + Intronic
962343738 3:134605247-134605269 GGCTTCCAGGGCCACAGGGAGGG + Intronic
966470546 3:180283919-180283941 TGCCCCCAGTTCTACAGGGAGGG + Intergenic
968705167 4:2074285-2074307 GACCCCCAGCCCTTCAGGGATGG + Intronic
971064036 4:23007210-23007232 GACTTCAACTGCTTCAGGGAGGG - Intergenic
975127158 4:70795724-70795746 GACCCTCAGTTCTTCAGGGATGG - Intronic
976559855 4:86488850-86488872 GAGCTACACTGCCACAGGGAAGG - Intronic
978533575 4:109738085-109738107 GTACTCCAGTGCTACAAGGTGGG - Intergenic
978593331 4:110350300-110350322 CTCCTCCAGTGCTGCAGAGATGG - Intergenic
979207024 4:118050344-118050366 GACTTCCAGTGCTATAGGAGTGG - Intronic
980242967 4:130201717-130201739 GCCCACCACTGCTGCAGGGAGGG + Intergenic
980612270 4:135174399-135174421 GAACTCAAGTGTTACAGGAAAGG + Intergenic
984061723 4:174996884-174996906 GACCTTCTGTTCTTCAGGGATGG - Intergenic
985294112 4:188416308-188416330 GAGCACCAGTGCTCCAGGGCAGG + Intergenic
985534087 5:453444-453466 GACCTGGAGTGCTCCCGGGACGG + Exonic
985822911 5:2172524-2172546 GACCTGCAGTAGTTCAGGGATGG - Intergenic
988729494 5:33956813-33956835 GACCCCCAGTTCTTTAGGGATGG + Intronic
990487038 5:56269397-56269419 GCCCTCCAGAGCTGCAGAGAGGG - Intergenic
994878847 5:105460666-105460688 GCCCTGCAGAGCTACAGGAATGG - Intergenic
997436599 5:133880168-133880190 GAACTCTAGAGCTACAGGTAGGG + Intergenic
999960050 5:156744884-156744906 GACCTCCAGTGCAACACAGATGG + Intronic
1000767939 5:165315360-165315382 GATCTCCAGTGTTACAGGTGGGG - Intergenic
1001834980 5:174824234-174824256 GACCTCCAGTGCTGAAGGATAGG + Intergenic
1002347928 5:178561063-178561085 GACCACCAGCCCTGCAGGGAGGG + Intronic
1003173582 6:3738539-3738561 CACCCCCAGTGACACAGGGAAGG + Intronic
1007321549 6:41031951-41031973 GAGCTCCAGGGTTACTGGGAGGG + Intronic
1007966610 6:46009139-46009161 TACCTCCAGTGCTGCTGGCATGG + Intronic
1008541139 6:52547308-52547330 GAGATCCAGTGCTGCAGAGAGGG + Intronic
1008861287 6:56152648-56152670 CACCTCCAGTGCTTCATGCATGG + Intronic
1009989842 6:70828706-70828728 GACCTCTAGTTCTACATGTAAGG - Intronic
1010525198 6:76893348-76893370 GACTTACAGTTCCACAGGGATGG + Intergenic
1014255798 6:119159200-119159222 GACCTCCTGTGGAACAGAGAGGG + Intergenic
1019428596 7:988450-988472 CACCTCCAGGGCTCCAGGGGTGG + Intronic
1020989023 7:15172398-15172420 TACCTCCAGTCCCACAGAGAGGG + Intergenic
1022661762 7:32374403-32374425 GACCTCCAGGGCTAGAGAAAAGG + Intergenic
1023235398 7:38081253-38081275 AACCTGCAGTGCCACAGGGGTGG - Intergenic
1026627769 7:72011459-72011481 GTCTTCCTGTGCTTCAGGGATGG - Intronic
1031974259 7:128084055-128084077 GACTTCCAGTGCTGCTGGGCTGG - Intronic
1038117555 8:24574487-24574509 GGCCACCACTGCTGCAGGGAAGG + Intergenic
1039889324 8:41673557-41673579 GATCTAAAGTGCTACAGGGGAGG + Intronic
1040066803 8:43151953-43151975 AACCTCCAAAGCTACAGGGAGGG - Intronic
1042877195 8:73449945-73449967 CCCCACCAGGGCTACAGGGAGGG + Intronic
1043267181 8:78280787-78280809 GTACTCCTGTGCTACAGAGAGGG - Intergenic
1044409267 8:91867054-91867076 GCCCACCACTGCTGCAGGGAGGG + Intergenic
1045002787 8:97893019-97893041 GACCTCGAGGGCTCCAAGGAAGG + Intronic
1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG + Intronic
1045688202 8:104733705-104733727 TACCTCCTGGGGTACAGGGAAGG - Intronic
1045916850 8:107482035-107482057 GACCTTCAGTTCTTTAGGGATGG + Intronic
1048694609 8:137012221-137012243 GACTTACAGTTCTACAGGGCTGG + Intergenic
1049637137 8:143695114-143695136 CACCCCCAGTGCTGCAGGAACGG + Exonic
1049785586 8:144449216-144449238 GACTCCCAGGGCTACTGGGAAGG - Intergenic
1050603309 9:7274305-7274327 GTCCTCAAGTGCTGAAGGGATGG - Intergenic
1053041555 9:34877913-34877935 AACCCCCTGTGCTCCAGGGAGGG - Intergenic
1053239612 9:36486208-36486230 GACTTGCAGTTCTAGAGGGAAGG - Intronic
1055675060 9:78650347-78650369 GATCTCCTGTGCTACACTGAGGG - Intergenic
1055701215 9:78947802-78947824 GACTTACAGTTCTACAGGGCTGG - Intergenic
1056778571 9:89532484-89532506 GAACTCCAGTGGAACAAGGATGG + Intergenic
1057144301 9:92748060-92748082 GAACTCCAGGGGTACAGGGTGGG + Intronic
1057499576 9:95585908-95585930 GACCTCCACTCCTAGAGGGGCGG - Intergenic
1060207010 9:121688088-121688110 GACCTGCAGGGCCACAGGGCAGG - Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1061933442 9:133845033-133845055 GACCTCCACTGGCCCAGGGAAGG - Intronic
1186831835 X:13398498-13398520 GACCACAAGTGCTACAGGCATGG + Intergenic
1187152588 X:16694589-16694611 AACCTCCAGTGCTGCATGCAGGG - Intronic
1187486276 X:19707245-19707267 GTGCTCCAGTGCTTCAGGGGTGG - Intronic
1187669215 X:21651769-21651791 GGCCCCCAGTGCTACAGAAAGGG + Intronic
1189090746 X:38080099-38080121 CAGCTCCAGGGCTAAAGGGAAGG + Intronic
1189284407 X:39841141-39841163 GACTTTCAGGGCTTCAGGGAAGG - Intergenic
1190155472 X:47988331-47988353 GATCCCCAGTGTTAAAGGGAGGG + Intronic
1190414414 X:50167091-50167113 GACCCCTGGTGCTTCAGGGAGGG - Intergenic
1190458255 X:50645760-50645782 GACCTCCTGTGCTCAGGGGACGG + Intronic
1190938831 X:55020677-55020699 TACCTCCAGTCCTAGAAGGAAGG - Intronic
1191884170 X:65872660-65872682 AAGCACCAGTGATACAGGGAAGG - Intergenic
1199603368 X:149556824-149556846 CACCTGCAGAGCCACAGGGATGG + Intergenic
1199647019 X:149922651-149922673 CACCTGCAGAGCCACAGGGATGG - Intergenic
1200292297 X:154885633-154885655 GACCTCCACAGCTGGAGGGATGG + Intronic
1200339134 X:155381370-155381392 GACCTCCACAGCTGGAGGGATGG + Intergenic
1200347335 X:155459322-155459344 GACCTCCACAGCTGGAGGGATGG - Intergenic
1201738036 Y:17291925-17291947 GACTTACAGTGCCACAGGGCTGG + Intergenic