ID: 1045264128

View in Genome Browser
Species Human (GRCh38)
Location 8:100604547-100604569
Sequence GATGCAGGACTAGCCCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045264113_1045264128 18 Left 1045264113 8:100604506-100604528 CCAAAGGTCAGCCCCCCTCCACT 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264114_1045264128 7 Left 1045264114 8:100604517-100604539 CCCCCCTCCACTCACCAAGCCAT 0: 1
1: 0
2: 4
3: 64
4: 498
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264118_1045264128 4 Left 1045264118 8:100604520-100604542 CCCTCCACTCACCAAGCCATGGG 0: 1
1: 0
2: 11
3: 29
4: 247
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264115_1045264128 6 Left 1045264115 8:100604518-100604540 CCCCCTCCACTCACCAAGCCATG 0: 1
1: 0
2: 4
3: 40
4: 329
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264116_1045264128 5 Left 1045264116 8:100604519-100604541 CCCCTCCACTCACCAAGCCATGG 0: 1
1: 0
2: 2
3: 35
4: 280
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264120_1045264128 3 Left 1045264120 8:100604521-100604543 CCTCCACTCACCAAGCCATGGGC 0: 1
1: 0
2: 1
3: 40
4: 262
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264122_1045264128 -7 Left 1045264122 8:100604531-100604553 CCAAGCCATGGGCCCCGATGCAG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data
1045264121_1045264128 0 Left 1045264121 8:100604524-100604546 CCACTCACCAAGCCATGGGCCCC 0: 1
1: 1
2: 3
3: 17
4: 284
Right 1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045264128 Original CRISPR GATGCAGGACTAGCCCCACC TGG Intronic
No off target data available for this crispr