ID: 1045266355

View in Genome Browser
Species Human (GRCh38)
Location 8:100621876-100621898
Sequence CCCTTCCTTCCTTCTTCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 365}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045266355_1045266362 1 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266362 8:100621900-100621922 AGGGTCCTCGCCTTCAGCTGGGG No data
1045266355_1045266366 26 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data
1045266355_1045266360 -1 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266360 8:100621898-100621920 GCAGGGTCCTCGCCTTCAGCTGG No data
1045266355_1045266361 0 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266361 8:100621899-100621921 CAGGGTCCTCGCCTTCAGCTGGG No data
1045266355_1045266365 23 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266365 8:100621922-100621944 GCTGCTAATCTTGAAGCAAATGG No data
1045266355_1045266367 27 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266367 8:100621926-100621948 CTAATCTTGAAGCAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045266355 Original CRISPR CCCTTCCTTCCTTCTTCCGA GGG (reversed) Intronic
900593186 1:3468796-3468818 CCCTTCTTTCCTCCTCCTGATGG - Intronic
900895517 1:5480366-5480388 CCCTGCCTTCCTTCACCCCAGGG - Intergenic
900925821 1:5705528-5705550 CCCTCTCCTCCTTCTTCCGCTGG - Intergenic
903137789 1:21320766-21320788 CCCTTCCTTCATTCTGCGGAGGG + Intronic
904643748 1:31950276-31950298 CCTTTCCTTCCTTCTTCAGGCGG - Intergenic
905018642 1:34793789-34793811 CCCTTCCTCCCTTTTGCCCAAGG - Intronic
905809759 1:40903507-40903529 ACCTTCCTACCTTCTTCACATGG - Intergenic
906117324 1:43365521-43365543 CCTTTCCTTCCTTCTTTCCCGGG - Intronic
906223984 1:44105991-44106013 TCCTTCCTTCCTTCCTGAGATGG - Intergenic
907052555 1:51339598-51339620 CCCTCACTCCCTTCTTCCTAAGG + Intronic
908031218 1:60001776-60001798 TCCTTCCTTGCTTCTTTCAATGG + Intronic
908769522 1:67583395-67583417 CCCTTACTTTCTTCCTCAGAGGG + Intergenic
909268605 1:73594125-73594147 TCCTTGCTTCCTTCTTTCCACGG + Intergenic
909463573 1:75946902-75946924 TCCTTCCTTCCTTCTTCCACAGG + Intergenic
909677038 1:78250270-78250292 CTCTTCCTTCTATCTTCTGAAGG - Intergenic
910476592 1:87614451-87614473 CCCTTCCTTTCTTCTTCAACTGG - Intergenic
911162794 1:94698375-94698397 CCCTTCCCTGCTCCTTCCCAAGG - Intergenic
911887802 1:103326403-103326425 CCCTTCCTTCCCCTTTCCAAAGG + Intergenic
912222821 1:107697743-107697765 CCATACCTACCTTCTTCCCATGG - Intronic
914646797 1:149660373-149660395 CTCTTCATTCCTTCTTCCACAGG + Intergenic
915856891 1:159397665-159397687 CTCTTCCTTTCTTTTTCCAAAGG - Intergenic
915952811 1:160201119-160201141 CCCTTCCTTTCATCTGCCAAAGG - Intronic
916822167 1:168410186-168410208 CCCTTCCTCCCTCCTTCCGTTGG - Intergenic
919564005 1:199160961-199160983 CCCTCCCTTCCTTCCTTGGAAGG - Intergenic
920154516 1:203937613-203937635 CCCTTCCTTTTTTCTTGAGACGG - Intergenic
920230374 1:204466136-204466158 CCCTCACTTCCTTCTCCCTAGGG - Intronic
920331379 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG + Intronic
921063886 1:211609216-211609238 TCTTTCCTCTCTTCTTCCGAAGG - Intergenic
921238703 1:213154485-213154507 CTCTTCCTTCCCTTTTCTGAAGG + Intronic
922070181 1:222184421-222184443 CCCTCCCTTCCTTCTGCTGAAGG - Intergenic
922975882 1:229782990-229783012 TCCTTGCTGCCTTCTTCCAAAGG - Intergenic
922976174 1:229785296-229785318 TCCTTGCTGCCTTCTTCCGAAGG + Intergenic
923242181 1:232096922-232096944 CTCTTGCTTCATTCTTCGGAAGG - Intergenic
923895246 1:238262198-238262220 TCCTTCCTTCCCTCTTGAGATGG - Intergenic
1062866031 10:855402-855424 CCCTACATTCCCTCTTCTGAGGG - Intronic
1063225782 10:4013487-4013509 CCCTCCCTTCCTGCTTCCCTAGG + Intergenic
1063578809 10:7287043-7287065 ACATTCCTTCCTTGTTCAGAGGG - Intronic
1064362462 10:14678294-14678316 CCCTTCCTTTCTTCCTCGGTGGG + Intronic
1064409016 10:15089064-15089086 TCCTTCTTTCTTTCTTTCGAAGG - Intergenic
1064462287 10:15546668-15546690 CCTTTCCTTCCTTTCTCCTAAGG - Intronic
1065605071 10:27409800-27409822 TCTTTCCTTCCTTCTTCCTGTGG - Intronic
1065809844 10:29431233-29431255 TCCTTCCTTCCTTCTTTCACAGG + Intergenic
1068130019 10:52885243-52885265 GGCTTCCTTCTTTCTTCTGAGGG + Intergenic
1068948235 10:62751000-62751022 CACCTCCTTCCTTCTACAGATGG - Intergenic
1068993667 10:63178408-63178430 ACCTTCCTTCCCTGTTCCAAGGG + Intronic
1070786310 10:79164156-79164178 GCCTTCTCTCCTTCTTCCCAGGG + Intronic
1070957460 10:80473877-80473899 CCCCTCCTTCCATCCTCAGAGGG + Intronic
1071046641 10:81387300-81387322 CTCTTCTTTCCTACTTCCAAAGG + Intergenic
1071525803 10:86357465-86357487 CCCTTCATTCCTTATTGCCATGG - Intronic
1072430771 10:95368952-95368974 CCCTCCCTTCCTTCCTCCCACGG + Intronic
1072744449 10:97930000-97930022 GCCTTCCTTCCCTCATCCCAAGG + Intronic
1073755507 10:106576611-106576633 CCCTTCCTTCCTTATTCTACCGG + Exonic
1073888571 10:108070220-108070242 TCCTTCCTTCCTTCTTGTGAGGG + Intergenic
1074094444 10:110297600-110297622 GCCTTCCTTCCTTCTTCTACAGG + Exonic
1074631673 10:115261995-115262017 GCCTGACTTCCTTCTTCAGATGG - Intronic
1075302429 10:121337281-121337303 CCCTCCCTTCCTTCTTAGAACGG + Intergenic
1075511724 10:123077789-123077811 CCCTTCCTTCCCTCATTAGATGG + Intergenic
1075721258 10:124588886-124588908 CCCTTCCTTCCTCATTCCCAGGG - Intronic
1077057426 11:601568-601590 CACTTTCTTCCGTCTTCCTAAGG - Exonic
1077354022 11:2106467-2106489 TCCTTCCTTCCTTCCTTCCATGG - Intergenic
1079069418 11:17329992-17330014 CCCTTCCTTCTTACCTCCAAAGG + Intronic
1079357219 11:19739804-19739826 CCGCTGCTTCCTTCTTCAGAGGG - Intronic
1079921796 11:26442173-26442195 CCTTTCCTTCCTTTTTCCATTGG + Intronic
1080200970 11:29669505-29669527 CCCTTTCTGCCTGCTTCCAAGGG + Intergenic
1080591172 11:33724154-33724176 TCCTTCCTTCCTCCTTCCGTGGG - Intronic
1080637696 11:34138233-34138255 CTCTGCCTTCCCTGTTCCGAAGG - Intronic
1081212339 11:40352180-40352202 TCCTTCCTTACTTCCTTCGAAGG + Intronic
1081620602 11:44617083-44617105 CGCTTCCTTCCTAGCTCCGAGGG - Intronic
1081795689 11:45817843-45817865 CCCTTTCTTCACTCTTCCCATGG - Intergenic
1082865563 11:57897096-57897118 TCCTGCCTTCCTTCTTCCCAAGG - Intergenic
1083353561 11:62048332-62048354 CCCTTCCCTCCCTCTTCCTAGGG + Intergenic
1083363715 11:62128871-62128893 CCCCTCCTACCTTCTCCTGATGG - Exonic
1083471667 11:62888353-62888375 CCCTCCTTTCCTTGTTCCGGCGG + Exonic
1083503842 11:63137009-63137031 CACCTCCTTCCTTCTCTCGATGG + Intronic
1084064976 11:66698874-66698896 CCCTTCATGGCTTCTTCCCAAGG - Intronic
1084195493 11:67522033-67522055 CCCTTCCTTCTTGCTTCCCGGGG + Intronic
1084317795 11:68355338-68355360 CCCTTGCTCCCTTCTTCCTGGGG - Intronic
1085104527 11:73830728-73830750 CCCTTCATTCCTCCTTCGAAAGG + Intronic
1086007058 11:82049128-82049150 CTCTTCCTTCCTCTTTCCAAAGG - Intergenic
1086576483 11:88344289-88344311 CCTTTCCTTCCTTCTTTAGCAGG - Intergenic
1088039827 11:105366246-105366268 CCCATCTTTCCTCCTTCCAAGGG + Intergenic
1088142708 11:106636695-106636717 CCCTACATTCCCTCTTCCCAGGG + Intergenic
1088538860 11:110891898-110891920 TCCTACCTTCCTTCTTCAGCAGG + Intergenic
1088585439 11:111356642-111356664 CCCTTCCTTCCTTCATTCCCGGG + Intronic
1088933778 11:114378438-114378460 GCCTTCCTTCCCTCCTCCCAAGG - Intergenic
1089221529 11:116876100-116876122 ACCTTCTTTCCTTCTTTCCAAGG + Intronic
1089898935 11:121961263-121961285 ACCTTCCTTCCTTATTCTTAGGG + Intergenic
1090048997 11:123360818-123360840 TCCTTCCTTCCTTCCTTCCATGG + Intergenic
1091804613 12:3346840-3346862 TCCTTCCTTCCTTCCTTCCAGGG + Intergenic
1091882188 12:3988989-3989011 CCCTGCCTTCCATCTTCTGGGGG + Intergenic
1092167766 12:6353536-6353558 CTCTTCCTTCCTTCTGCTGCAGG + Intronic
1092183646 12:6462981-6463003 CCCTTTATTCCTTCTTCCCTCGG - Intronic
1092354541 12:7783686-7783708 CCTTTCTTTCTTTCTTTCGATGG + Intergenic
1092498847 12:9025766-9025788 CCCATCTTTCCTTCTTCCATGGG - Intergenic
1092526081 12:9311122-9311144 CCCTCCCTTCCTTCCTTAGATGG + Intergenic
1092541200 12:9420661-9420683 TCCTTCCTTCCTTCCTTAGATGG - Intergenic
1093235812 12:16607169-16607191 CCCTTCCTCCCTTCCTCTAATGG + Intronic
1094599736 12:31898154-31898176 CCCTTCTTTCTTTCTTTCCAGGG - Intergenic
1097473185 12:60021373-60021395 CTCTTCCTTCCTCTTTCCAAAGG + Intergenic
1097506964 12:60485636-60485658 CCCTTCCATGCTTATTCAGAGGG + Intergenic
1100636409 12:96438721-96438743 CACTTCCATCCTGCTTCCTAGGG + Intergenic
1101058286 12:100943085-100943107 CCCTTCCTTCCTTCTCTGCATGG + Intronic
1101519083 12:105465101-105465123 CTCTTGCTTCCTCCCTCCGAAGG + Intergenic
1101732788 12:107440420-107440442 CTCGTCCTTCCTGCTTCAGAAGG + Intronic
1102031595 12:109743150-109743172 CCCTTCCTCCCTTCTTGCTAAGG - Intronic
1103348719 12:120267986-120268008 CCCTGGCTTCCTTCTTCCCTTGG + Intergenic
1103470471 12:121176302-121176324 CTTTTCCTTCCATCTTCAGAAGG - Intronic
1104510836 12:129376337-129376359 CACATCCTTTCTTCTTCCCATGG + Intronic
1104719059 12:131034519-131034541 CCCTTCCTTCCTCCACCCCATGG - Intronic
1106147582 13:27063835-27063857 CCCTTCCTCCCTTCCCCCCAGGG - Intergenic
1106511327 13:30415284-30415306 CCCTCCCTTTCTTCTTCCTCTGG + Intergenic
1107398105 13:40039616-40039638 CCCTTCCTCTCTTCTGCCCAGGG + Intergenic
1107837666 13:44424735-44424757 TCCTTCCTTCTTTTTTCTGATGG + Intergenic
1108316738 13:49244050-49244072 CCTTTCCTTCCTTCTTTCCCTGG + Intergenic
1108559573 13:51628668-51628690 TCCTGCCTCTCTTCTTCCGATGG - Intronic
1108697007 13:52911313-52911335 TCATTCCTTCCTTCATCTGATGG + Intergenic
1109022705 13:57118911-57118933 CCCTTCCCTTCTTTTTCCAAAGG + Intergenic
1110676361 13:78250729-78250751 CCTCTCCTCCCTTCTTCCTATGG - Intergenic
1112267628 13:97939769-97939791 CCCTTCCTTTCTTCAGCCAAAGG + Intergenic
1112648216 13:101360233-101360255 TCCTTCCTTCCTTCCTTCGATGG + Intronic
1113237977 13:108302754-108302776 CACTTTCTTCTTTCTTCCGTAGG + Intronic
1113493806 13:110713072-110713094 CCCTTCCTTCCGCCTCCCGGAGG + Intronic
1114004957 14:18302367-18302389 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1116746734 14:48830028-48830050 TCCTTCCTTCCTTCCTTCCACGG - Intergenic
1117767383 14:59097127-59097149 CCTTTCATTCATTCTTCCTAAGG + Intergenic
1118017452 14:61674652-61674674 CCTTTCCCCCCGTCTTCCGACGG + Intergenic
1118319073 14:64742794-64742816 CCTTTTCTTCATTCTTCCTATGG + Intronic
1118986049 14:70755694-70755716 CCTTTCATTCCTTCTTCCTCAGG - Intronic
1119234102 14:73005267-73005289 CCCTTCCTTCCCTCATCAAAGGG - Intronic
1121119926 14:91370248-91370270 CCCTCCCTTCCCCCTTCTGAAGG - Intronic
1121728515 14:96170342-96170364 CCCATCCCTCCTCCTTCCCAAGG - Intergenic
1122693763 14:103543196-103543218 CCATTCCTTCATTCTGCAGATGG + Intergenic
1122724638 14:103742157-103742179 GCCTTCCTTCCTCCTTTCCAGGG + Exonic
1123389415 15:19854601-19854623 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1123985576 15:25643258-25643280 CCCTCCCTTCCATCTGCAGAGGG + Intergenic
1125150101 15:36521427-36521449 CCCTTCCTTCCTTCCTTCTATGG - Intergenic
1125783877 15:42297727-42297749 CTCTTTCTTCCTTCTACAGAAGG + Intronic
1126268292 15:46780956-46780978 CCCTCCCTTTCTTCTTCCCTTGG + Intergenic
1127303388 15:57679550-57679572 TCCTTCCTTTCTTCTTAGGAAGG - Intronic
1128702979 15:69817503-69817525 CCCTCCCTTCCTTCCTTCCATGG - Intergenic
1129294293 15:74591447-74591469 CCCTTTCTTCCTTCTCCCCCAGG - Intronic
1130989977 15:88870357-88870379 CCCCTTCTTCCTTCTTCCCCTGG - Intronic
1131513021 15:93059899-93059921 ACTTTCCTTCCTTCTTTCCATGG - Intronic
1131744349 15:95430036-95430058 TCCTTCCTTCCTTCTTTCCTTGG + Intergenic
1132912230 16:2319986-2320008 CGTTTCCTTCCTTCTCCCGTGGG - Intronic
1133249229 16:4469370-4469392 CCTTTGCTGCCTTCTTCCTAGGG + Exonic
1133453574 16:5923330-5923352 CCCTTCCAGCCTTGTTCTGAGGG - Intergenic
1134537132 16:15035073-15035095 CCCTTCCTTCATTCTTTCCCAGG + Intronic
1135835252 16:25819469-25819491 CCCTTCCTTCCTAATTCGGTGGG + Intronic
1137820841 16:51444224-51444246 CCCATTCCTCCTTCTTCCCAAGG - Intergenic
1138349452 16:56338719-56338741 CCCTTGCTTCCATCTTCCAGAGG - Intronic
1138609399 16:58110803-58110825 CCCTCGCTTCCTTCTTCCTCTGG + Intergenic
1139264384 16:65625416-65625438 CCCCTCCTTCCTCCTACAGAGGG + Intergenic
1139300578 16:65942192-65942214 TCCTTCCTTCCTTCTTTCCTGGG - Intergenic
1141501968 16:84450582-84450604 CCCTTCCTCCCCTTTTCCAATGG - Intronic
1141811665 16:86380159-86380181 CCCCTCCTTCCTCTTTCTGATGG - Intergenic
1141843814 16:86593454-86593476 CGTTTCCTTCCTGCTTCTGAAGG + Intergenic
1141907718 16:87038577-87038599 TCCTTCCTTCCTTCCTTAGATGG - Intergenic
1142121076 16:88386993-88387015 CCCATCTTTCCTTCTACCCAGGG - Intergenic
1143253747 17:5540843-5540865 ACGTCCCTTCCTTCTTCCCAAGG - Intronic
1143538399 17:7555512-7555534 CCTCGCCTTCCTCCTTCCGATGG - Intronic
1143655156 17:8289584-8289606 CCGTTCCTTCCTCCTTACGGGGG - Exonic
1144081390 17:11767188-11767210 CCCTTCCTTCCTTCTAGAGGTGG + Intronic
1144771758 17:17763383-17763405 CCCTTCCTTGCTTGTTCCTATGG + Intronic
1146397720 17:32482059-32482081 TCCTTCCTGCCTTCTTCTGCTGG + Exonic
1147443542 17:40461736-40461758 CCTTTCCTTCTTTCTTCTGTGGG + Intergenic
1147626514 17:41904111-41904133 CCCTTCCTTTCTTCCTTCCATGG - Intronic
1147700320 17:42389694-42389716 CCCATCATTCCTTCTCCCCAAGG + Intergenic
1148124782 17:45231061-45231083 CCCTTCCTCCCTCCCTCCCATGG - Intronic
1149290122 17:55209816-55209838 CATTTACTTCCCTCTTCCGAGGG + Intergenic
1152688495 17:81706884-81706906 CCCTTCTTTCCTGCTCCCTAAGG + Exonic
1153794322 18:8609229-8609251 CGCTTCCCTCCCTCTTCCGCCGG - Intergenic
1154532466 18:15361512-15361534 CCCTTTCTCCCTCCTTCAGATGG - Intergenic
1155078204 18:22381628-22381650 CTCTTCCTTCCTCCTTCTGCTGG + Intergenic
1155272765 18:24156912-24156934 CCCTTCCCTCCTGCTCCAGAAGG + Exonic
1156579295 18:38356503-38356525 CCCTTCCTTCCTTTTTGAGGTGG + Intergenic
1157450030 18:47779317-47779339 CTCTTACTTCCTTATTCGGATGG + Intergenic
1158558418 18:58493758-58493780 CTCGTCGTTCCTTCCTCCGAGGG + Intronic
1159520958 18:69522880-69522902 TCCTTGCTTCTTTCTTACGAGGG + Intronic
1159590816 18:70333137-70333159 CCCTTCCTTTCTTCTTTCTAAGG - Intergenic
1160436534 18:78856503-78856525 CCCTTCCTGCCTCCCTCCCATGG + Intergenic
1160509144 18:79443684-79443706 CCCTTGAATCCTTCTGCCGACGG + Intronic
1164691098 19:30211288-30211310 CCCTTCTTTCCTTCTGCAGAGGG + Intergenic
1164855451 19:31517370-31517392 CTCCTTCTTCCTTCTTCCCACGG - Intergenic
1165216174 19:34274399-34274421 TCCTTCCTGCCTTCTTGAGACGG - Intronic
1166082366 19:40452063-40452085 CCCCTCCTTCCCTCCTCCCAAGG + Intronic
1166690966 19:44821040-44821062 CCCTCCCTTCCTTCCTCTGCCGG + Exonic
1167236691 19:48320030-48320052 CCCTTCCTTCCTTCTCCCCTTGG + Exonic
1167270660 19:48503869-48503891 CCCTTCCTTCCTCTTTGAGAGGG + Intronic
925037291 2:698138-698160 CTCTTCTTTTCTTCTTCCTAAGG + Intergenic
926192926 2:10741913-10741935 TCCTTCCTTCCTTCCTTCCATGG + Intronic
927095136 2:19742597-19742619 CCCTCCCTTCCCTCTTCCCGTGG - Intergenic
928312604 2:30223086-30223108 TCCTTCCTTCCTTCCTTCCAAGG - Intergenic
929654414 2:43716206-43716228 CCCCTCCTCCCTTCTTCCAGGGG - Intronic
930695039 2:54402600-54402622 CCCTTTCTCCCTTCTCCCCATGG - Intergenic
930713239 2:54569158-54569180 CCGTTCCTTTCTTCTTCCCAGGG - Intronic
930753064 2:54950599-54950621 CTCTCCCTTCCTTCCTCTGAGGG + Intronic
931925149 2:67064441-67064463 ACCTTCCTTCCTTCTTCCTGTGG + Intergenic
933749519 2:85594204-85594226 CCCTTCCTTCCTTTTTCGACGGG + Intergenic
933846692 2:86332545-86332567 CCCTTCCCTCATTCTCCCCAGGG + Intronic
935989819 2:108709218-108709240 TCCTTCCTTCCTTCTTGTGAAGG - Intergenic
936992316 2:118379285-118379307 CCCTTCCTTCATTCTTTCCCTGG - Intergenic
938531566 2:132192732-132192754 CCCTTTCTCCCTCCTTCAGATGG - Intronic
938711198 2:133977595-133977617 CCCTTTCTTTCTTCTGCCGCAGG - Intergenic
938739941 2:134221544-134221566 TCCTTCCTTCCTTCTTTCCCAGG - Intronic
939311748 2:140488266-140488288 GCCTTTCTTCCTGCTTCAGATGG + Intronic
939437321 2:142195182-142195204 CCCTTCCTCCCTTCCTCCTTTGG - Intergenic
939864019 2:147452569-147452591 TCCTTCCTTCCTTCCTCTAAAGG - Intergenic
940907839 2:159184688-159184710 CCCCTCCTCCCTTATTCCCATGG - Intronic
941039518 2:160604910-160604932 CCCTTCCTACTTTCATCCCAAGG + Intergenic
942709548 2:178817805-178817827 CCCTCCCTCCCTTCTTTCAATGG + Intronic
942776575 2:179589131-179589153 ACCTTCCTTAATTCTTCCCAAGG - Intronic
943489631 2:188534483-188534505 CCCCTCCTTCCTTCTCCCTCTGG - Intronic
944363576 2:198889833-198889855 CCCTTTCTGCCATCTTCAGAAGG - Intergenic
945118290 2:206431591-206431613 CCCTGCCTCCCTCCTTCCCAAGG - Intergenic
945213603 2:207410091-207410113 CCCTGCCTTCCTTCAACCGTGGG + Intergenic
948143579 2:235692290-235692312 CCCTGCCTTCCATCTTCCCCAGG + Intronic
948257571 2:236578986-236579008 CCCTTTCTTCTTTCTTCTTAGGG + Intronic
948361855 2:237427348-237427370 TCCTTCCTTCCTTCTTTAGATGG - Intergenic
948786197 2:240354212-240354234 CACTGTCTTCCTTCTTCCCAGGG + Intergenic
948797534 2:240412517-240412539 CCCGGTCTTCCTCCTTCCGAAGG + Intergenic
949047800 2:241880161-241880183 CCCTTCCTTTCTTCTGCTGGCGG - Intergenic
1169143212 20:3237676-3237698 TCATTCCTTCGCTCTTCCGAGGG + Intronic
1169889315 20:10435281-10435303 CGCTTACTTCCTCCTTCCCAGGG - Exonic
1170632945 20:18080916-18080938 CCTTTCCTTCCTTTTTTGGATGG - Intergenic
1170702113 20:18713022-18713044 CCCAGCCTTCCTTCTTCCTTTGG + Intronic
1171105383 20:22428333-22428355 CCCTCCCTTTCTTCTTTCCATGG + Intergenic
1172320059 20:33989357-33989379 CCCTTCCTTCCTTCCTAACAAGG + Intergenic
1172919744 20:38471547-38471569 CCTTCCCTTCCTTCTTCCCTTGG - Intergenic
1173687051 20:44931091-44931113 TCCTTCCTTCCTTCCTTCGTGGG + Intronic
1174538636 20:51272332-51272354 CCCTTCCATCCTCCTTTCTATGG + Intergenic
1174748109 20:53084725-53084747 CCCTTCCTTCCTTCCTTCTTTGG + Intronic
1175178250 20:57126800-57126822 CCCTTCCTTCTTTCTTTCAACGG - Intergenic
1175265848 20:57703163-57703185 TCCTTCCTGCCTTCTCCCCAGGG - Intronic
1175785814 20:61711212-61711234 TCCTTCCTGCCTTCTTGTGAAGG + Intronic
1176764894 21:13006698-13006720 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1177148641 21:17432722-17432744 CCCTTCCTTCCTTCTTCTATGGG - Intergenic
1177458812 21:21381936-21381958 CTCTTCCTTCCTATTTCTGAAGG + Intronic
1179091348 21:38268872-38268894 CCCCACCTTCCTTCTTCCCCAGG + Intronic
1179335597 21:40449245-40449267 CCCTTACTTCCCTTTTCCCATGG + Intronic
1179613629 21:42567872-42567894 CCCCTCCTCCCTTCTTCCCCTGG + Intronic
1180429469 22:15233157-15233179 CCCTTTCTCCCTCCTTCAGATGG + Intergenic
1180512081 22:16101491-16101513 CCCTTTCTTCCTCCTTCAGATGG + Intergenic
1181324761 22:22036358-22036380 CCCTTCCTCCCTTCTGCCACTGG - Intergenic
1181487634 22:23241561-23241583 CCCTTCCCACCCTCTTCCCAGGG + Intronic
1182943494 22:34300522-34300544 CCCTTCCTTCCTTCTTCAGATGG + Intergenic
1182972841 22:34593848-34593870 CCCTTCCTTCCTTCCTTTGATGG - Intergenic
1183006831 22:34910311-34910333 CCCTTCCTCCTTTCTTTCCAAGG - Intergenic
1183855591 22:40631820-40631842 CCATTCCTTCATTCCTCCAAAGG + Intronic
1184472095 22:44701991-44702013 ACCCTCCTCCCCTCTTCCGAGGG - Intronic
1184591129 22:45484131-45484153 CCCTTCCTTCCTTCTGTACAAGG - Intergenic
1184606839 22:45579264-45579286 CCATCCCTTCCTTCTTCCGTAGG + Intronic
1184691435 22:46119150-46119172 CCCTTTCTTCCTTCCTCTGGAGG - Intergenic
1184875748 22:47274378-47274400 ACCTTCCCTCCATCTTCCGCTGG - Intergenic
1185037024 22:48484720-48484742 CCCTTCCTTCCTTCCTGACAGGG + Intergenic
949540908 3:5031376-5031398 TCCTTCCTTCCTTTTTTTGATGG - Intergenic
950361315 3:12451346-12451368 CTGTTCCTTCCCTCTTCTGAGGG - Intergenic
952960145 3:38583926-38583948 CCCAACCTTCCCTCTTCCTAAGG + Intronic
953558046 3:43962570-43962592 CCTTTCCTTCCATCCTCAGAAGG - Intergenic
953998042 3:47535903-47535925 TCCTTCCTTCCTTCCTTCCAAGG + Intergenic
955752596 3:62197581-62197603 GCCTTCCTTCCTTCTCCCCTAGG - Intronic
958443310 3:94182744-94182766 TCCTTCCTTCCTTTCTCCCAAGG + Intergenic
958631148 3:96685531-96685553 ACCTTCCCTCCTTTTTCCAAAGG + Intergenic
959975835 3:112458361-112458383 CAATTCCTTCCTTCTACTGATGG + Intergenic
960171915 3:114472371-114472393 CTCTTTCTTCCTTTTTCCCAGGG - Intronic
960356793 3:116663714-116663736 CCCCTCCTTCCTGCTCCCGCAGG - Intronic
961163425 3:124748620-124748642 CCCTTCCTCCCTCCTTCCCTGGG - Intergenic
962688431 3:137869200-137869222 CCCTTCCTTCCCTTTCCCAAAGG - Intergenic
962983059 3:140508149-140508171 ACCCTCCTTCCTTCTCCCCATGG + Intronic
963123840 3:141797471-141797493 TCTCTCCTTCCTTCCTCCGAGGG - Intronic
963731706 3:148980948-148980970 CCATTCCCTCCTACTTCCAAAGG + Intergenic
964059541 3:152505085-152505107 CCCTTCCTTCCCCTTTCCGAAGG + Intergenic
964107567 3:153055778-153055800 CCCTTCCTTCCTTCCTTCGATGG - Intergenic
964318180 3:155465896-155465918 CTCTTCCCTCCTTTTTCCAAAGG - Intronic
965833173 3:172820173-172820195 GCCTTCCTTCCTTCTTTGAAAGG + Exonic
966383278 3:179365669-179365691 CCCTTCTGTCCTACTTCCCAAGG + Intronic
966896248 3:184447409-184447431 CCCTTCCTCCCCTCTCCTGAGGG + Intronic
967530172 3:190540261-190540283 GCCTTCCTCCCTCCTTCCCAAGG + Intronic
967929096 3:194677739-194677761 CCCCTCCTTCCATCTTCAGAGGG + Intergenic
969513276 4:7631780-7631802 CCCTCCCTTCCCTCTTCACAGGG + Intronic
970920172 4:21384841-21384863 CCCTTTCTGCCTTCTCCCCAGGG - Intronic
970992042 4:22223788-22223810 TCCTTCCTTCCTTCTTCCACAGG - Intergenic
972148981 4:36065024-36065046 CCCTCCCTTCCTTCTCCCAGAGG - Intronic
972309676 4:37868395-37868417 CCCTTTCTGCCTGCTTCTGAGGG - Intergenic
973694556 4:53477224-53477246 CCCTTCCTTCCTTCCTTCAGCGG - Intronic
974578760 4:63766888-63766910 CTCTTCCTTTCTTCTTCCCTTGG + Intergenic
975138379 4:70896462-70896484 ACCTTCCCTCCTTCTCCCCATGG + Intergenic
975293610 4:72706593-72706615 CCCTTCCTTTCTTCCTTCCAGGG - Intergenic
976195456 4:82527631-82527653 CCCTCCATGCCTTCTTCCCATGG + Intronic
978030977 4:103939475-103939497 CTCTTCCTTCCTCTTTCCAAAGG - Intergenic
978645816 4:110930046-110930068 TCCTTTCTTCCTTTTTGCGAGGG - Intergenic
979340019 4:119511673-119511695 TCCTTCCTTCCTTCCTTCCAAGG - Intronic
980577268 4:134699373-134699395 TCCTTCCTTCCTTCTATCGGGGG - Intergenic
981310938 4:143297577-143297599 CCCTTTCTTGTTTCTTCCCAAGG + Intergenic
984786612 4:183573105-183573127 CCCTGTCTTCTTTCTTCCCATGG + Intergenic
984799369 4:183699335-183699357 CTCTTCCTTCTTTATTCCCATGG + Intronic
984990288 4:185373942-185373964 CCCTTCCCTACCTCTACCGAAGG - Intronic
990729449 5:58792413-58792435 CACTTGGTTCCTTCTTCAGATGG - Intronic
991095382 5:62734334-62734356 TCCATCTTTCCTTCTTCTGAAGG + Intergenic
991136771 5:63191588-63191610 CCCTTCCCTCCTCTTTCGGATGG + Intergenic
991691783 5:69232618-69232640 CCCTTCTTTCTTTCTTTTGACGG + Intergenic
993643991 5:90440326-90440348 ACCTTCCTTCCTTCTACCCTTGG - Intergenic
995244047 5:109917426-109917448 ACCTTCTTACCTTCTTCCCAAGG - Intergenic
995366533 5:111367799-111367821 CCCCTTCTTCCTTCTTCCTATGG + Intronic
995875491 5:116784843-116784865 CCCTTCCTGCCTTATGCCGAAGG + Intergenic
996042974 5:118837165-118837187 CACTTTCTTCCTCCTTCCCAGGG - Intergenic
1000110127 5:158100168-158100190 CCCTTCAGTCCTGCTTCTGAAGG - Intergenic
1000789830 5:165592185-165592207 TCCTTCCTTCCTTTTGCAGATGG - Intergenic
1000989215 5:167894913-167894935 TCCTTCCTTCCTTCTTTCCAGGG - Intronic
1001408698 5:171495268-171495290 TCCTTCCTTCCTTCCTCTGTGGG - Intergenic
1001412941 5:171523749-171523771 TCCTTCCTTCCCTTCTCCGAGGG + Intergenic
1003261038 6:4516436-4516458 TCCTTCCTTCCTTCTGCTGTTGG + Intergenic
1003379214 6:5607577-5607599 CCCTTCCTTCCTGCTTGAGATGG - Intronic
1003576322 6:7299313-7299335 CTCTTCCTTCCTTGTTTTGAAGG - Intronic
1003644616 6:7904556-7904578 CCCTTCCTTCCAACTTACGTGGG + Exonic
1003701940 6:8476196-8476218 TCCTTCCTTCCTTCTGCATATGG + Intergenic
1004793981 6:19060684-19060706 CCCCTCCTTCCTTCTGCTCATGG + Intergenic
1006358983 6:33577093-33577115 GCCCTCCTTCCCTCTTCCCAGGG - Intronic
1006475017 6:34247863-34247885 ACCTCCCTTCCTCCTTCCCAGGG - Exonic
1006683776 6:35815396-35815418 CCATTACTCCCTTCTTCCTAGGG + Intronic
1009334341 6:62467361-62467383 TCCTTCCTTCCTTCCTTCCATGG - Intergenic
1010774369 6:79868490-79868512 CCTTTGCTTCCTTTTTCCCAAGG - Intergenic
1012496921 6:99843936-99843958 TCCTTCCTCCCTTCTTCCCATGG + Intergenic
1013488227 6:110618528-110618550 CCTTTAATTCCTTCTCCCGATGG + Intronic
1014734253 6:125073713-125073735 CCCTTTCTTACTTCTTCATATGG - Intronic
1015997902 6:139013675-139013697 TCCTTCCTTCCTTCTTGACAGGG + Intergenic
1016124032 6:140376645-140376667 CCCTTCCTTCCTTCCTTCTTTGG + Intergenic
1016127838 6:140427967-140427989 CTTTTCCTTTCTTCTTCCAACGG + Intergenic
1017911585 6:158797548-158797570 ACATTCCAGCCTTCTTCCGAAGG + Intronic
1018576971 6:165269002-165269024 CCTTTCCTTCCTTCTCCCCAAGG - Intergenic
1020262819 7:6540116-6540138 CCCTTCCTTTCTTTTTGAGACGG + Intronic
1020389513 7:7643277-7643299 GGCTTCCTTCCTTTTTCCGGTGG - Intronic
1021330677 7:19335229-19335251 CCCTTCCGTCCTTCTCACTAAGG + Intergenic
1021969546 7:25952207-25952229 TCCTTCCTTCCCTCTCCCCAAGG + Intergenic
1023257777 7:38329138-38329160 CCCTTCTTTCCTAATTCAGAGGG + Intergenic
1023641347 7:42262263-42262285 CCCTTCCTTCTTTCTTTCATAGG + Intergenic
1023724909 7:43132806-43132828 CCCTTCTTTTCTTCTTCAGTTGG + Intronic
1024984566 7:55183838-55183860 CCCTTCCTCCGTTCATCAGAGGG + Intronic
1025212134 7:57025862-57025884 CCCTTCCTCCCTCCCTCCCACGG + Intergenic
1025659820 7:63550966-63550988 CCCTTCCTCCCTCCCTCCCACGG - Intergenic
1027180450 7:75935585-75935607 CCCTTCCTGCCTTTTTCCAAGGG + Intronic
1027752014 7:82161209-82161231 CCTTTCCTTCCTTTCTCTGAGGG + Intronic
1029459116 7:100685334-100685356 CCCTTCCTACCTTCGGCCGCTGG + Exonic
1029675312 7:102064621-102064643 CCCTTCCTCCCTCCCTCCCACGG + Intronic
1029722433 7:102377872-102377894 TCCTTCCTTCCTTTTTGAGATGG + Intronic
1030000164 7:105051187-105051209 TCCTTCCTTCCTTTTTTAGATGG + Intronic
1030838718 7:114320858-114320880 CCCTTCCTCCTTTCTTCCACAGG - Intronic
1031446280 7:121858492-121858514 CCCTCCCTACCTTCCTCCCAAGG - Intergenic
1031960146 7:127981780-127981802 CCCTTCCTTGCCTCTTCCACTGG + Intronic
1032902976 7:136332078-136332100 CCCTTGATTCCTTCTTTGGATGG + Intergenic
1033442190 7:141390219-141390241 ACCTTCCTTCCTTCTTTCCTGGG + Intronic
1033977170 7:147116529-147116551 CCCATCCATTCTTCTTCCCAGGG - Intronic
1034416207 7:150965557-150965579 CCCTTCCCTCCTGCTCCCCATGG + Intronic
1037268921 8:17103568-17103590 TCCTTCCTTCCTTCTCCAGTTGG - Intronic
1038360749 8:26873606-26873628 TCCTTCCCTTCTTCTTCAGAAGG + Intergenic
1040531155 8:48267414-48267436 CTCTTCCTTCCTTCCTCCCTAGG - Intergenic
1042726396 8:71882368-71882390 CCCTGCCATCCTTCCTCCCAAGG + Intronic
1045266355 8:100621876-100621898 CCCTTCCTTCCTTCTTCCGAGGG - Intronic
1045350254 8:101331668-101331690 TCCTTCCTTCCTTCCTTCCAGGG - Intergenic
1045394972 8:101751525-101751547 CCTTTCCTTCCTTCCTTCCATGG - Intronic
1045995813 8:108360108-108360130 CCTTTCCTTCCTTCTCCCTATGG + Intronic
1047362130 8:124178817-124178839 CCCTTCCAGCCTTGTTCCCAAGG - Intergenic
1047616207 8:126564475-126564497 GGCTTCCTTCCTTCATCTGAAGG - Intergenic
1048224027 8:132567634-132567656 CCCTTTCCTCCTTCTTCCTTAGG + Intergenic
1048718466 8:137296191-137296213 TCCTTCCTTCCTTCCTTGGAAGG + Intergenic
1049424066 8:142530281-142530303 CCCTTCCTTCCCTGTTCCCTTGG - Intronic
1050526831 9:6553668-6553690 TCCTTCCTTCCTTCCTCCTCTGG + Intronic
1052143391 9:25017508-25017530 CCCTTCCTTCCTTCTCTCTCTGG + Intergenic
1052386266 9:27827150-27827172 CCCTTCCTTCCTTCCTTGGCAGG + Intergenic
1053426113 9:38011173-38011195 CCCTTCTTTCCCTCTTCCCCAGG - Intronic
1053710176 9:40799228-40799250 CCCTTTCTCCCTCCTTCAGATGG - Intergenic
1054827198 9:69585417-69585439 CGCTTCCTTCATTCTTGCCAGGG + Intronic
1054945555 9:70792415-70792437 CACTTCCTTCCCTCTTCCTGGGG - Intronic
1055102981 9:72484256-72484278 CCCTTCTGTCCATCTTCCAAGGG - Intergenic
1055634450 9:78261388-78261410 CCCTTTCTCCCTTCTACCCATGG - Intronic
1055723986 9:79207900-79207922 TCTTTCCTTCCTTCTTTCCATGG - Intergenic
1056570018 9:87806703-87806725 CCCTTCCTGGCTTCCTCCGCAGG + Intergenic
1056629677 9:88282856-88282878 CCCTTCCTTGCTTCTGCAGATGG - Intergenic
1056813366 9:89781712-89781734 TCCCTCCTTCTGTCTTCCGATGG + Intergenic
1058872326 9:109213313-109213335 CCCTTCCTTCCATCTGCAAATGG + Intronic
1058977383 9:110137435-110137457 CCCTGGCTTCCTGCTGCCGATGG - Exonic
1059752158 9:117258070-117258092 TCCTTCCTTCTTCCTTCCAATGG - Intronic
1060230003 9:121819281-121819303 CCCTTCCTTCCAACCTCCTAGGG - Intergenic
1060297788 9:122355030-122355052 CTCTTCCTTCCCTCTTCCTTTGG - Intergenic
1061187544 9:129063523-129063545 CCCTCCCTTCCTCCTTCCCTAGG + Exonic
1061258494 9:129466491-129466513 CCCTGCAATCCTTCTTCCAAAGG - Intergenic
1062086525 9:134651986-134652008 CCCTTCCTTCTTTCTAAGGAGGG + Intronic
1185740190 X:2525849-2525871 CCCTTCCTTCCTTCTCGACAGGG + Intergenic
1185873719 X:3685204-3685226 CCCTTCCCTCCTTCTTTCATCGG + Intronic
1186389424 X:9144002-9144024 TCCTGCCTTCCTTCTCCCTAAGG + Intronic
1188513315 X:30959632-30959654 CTCTTTCTTCCTCCTTCCAATGG - Intronic
1189966264 X:46377203-46377225 CACTTCCTTCCCTCTGCCAAAGG - Intergenic
1190739559 X:53280249-53280271 CCCTTCCTCCCTTCCTGTGAGGG - Intronic
1192507718 X:71699148-71699170 CTCTTCCTTCCTTCCTCTCAGGG + Intergenic
1192518978 X:71782404-71782426 CTCTTCCTTCCTTCCTCTCAGGG - Intergenic
1193478260 X:81994608-81994630 CCGTCCCTCCCTTCTTCCTATGG + Intergenic
1193793505 X:85845034-85845056 TCCTTCCTTCCTTCCTCCAGAGG - Intergenic
1194323146 X:92477331-92477353 CTCTTCTTTCCTTTTTCCAAAGG + Intronic
1194476940 X:94369759-94369781 CTCTTCTCTCCTTCTTCCAAAGG - Intergenic
1194788777 X:98119315-98119337 CTCTTCCTTCCCCCTTCCAAAGG - Intergenic
1195037900 X:100986914-100986936 CTCTTCCTTCCCTCTTCCTCTGG + Intronic
1195802672 X:108731585-108731607 CTCTTCCTTACTTCTTCCTTTGG + Intronic
1197068631 X:122266607-122266629 CTCTTCCTTCTTTTTTCCAAAGG + Intergenic
1197836514 X:130699670-130699692 CCCTACCTTTCTTCTTGCCAAGG - Intronic
1198416563 X:136426009-136426031 CCCTTCCTTCCTTGTTCTACTGG - Intergenic
1198543336 X:137664360-137664382 TCCTTCCTTCCTTTTTTTGATGG + Intergenic
1198672112 X:139092108-139092130 CCCCTCCTTTCCTCTTCCCAGGG - Intronic
1200631244 Y:5590488-5590510 CTCTTCTTTCCTTTTTCCAAAGG + Intronic