ID: 1045266357

View in Genome Browser
Species Human (GRCh38)
Location 8:100621877-100621899
Sequence GCCCTTCCTTCCTTCTTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045266357_1045266367 26 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266367 8:100621926-100621948 CTAATCTTGAAGCAAATGGAGGG No data
1045266357_1045266361 -1 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266361 8:100621899-100621921 CAGGGTCCTCGCCTTCAGCTGGG No data
1045266357_1045266365 22 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266365 8:100621922-100621944 GCTGCTAATCTTGAAGCAAATGG No data
1045266357_1045266362 0 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266362 8:100621900-100621922 AGGGTCCTCGCCTTCAGCTGGGG No data
1045266357_1045266366 25 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data
1045266357_1045266360 -2 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266360 8:100621898-100621920 GCAGGGTCCTCGCCTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045266357 Original CRISPR GCCCTTCCTTCCTTCTTCCG AGG (reversed) Intronic
901401261 1:9016600-9016622 TCCCTTCCTTCCTTCCTTCCTGG - Intronic
901730198 1:11273455-11273477 CCCCGTCCTTCCTCCTTCCCGGG + Exonic
901817099 1:11800601-11800623 GCCCTTCCCTACTTCTACCTGGG + Intronic
903137787 1:21320765-21320787 ACCCTTCCTTCATTCTGCGGAGG + Intronic
903239735 1:21974828-21974850 GCCCCTCCCTCCTTCTTCCCTGG + Intergenic
903243541 1:21999758-21999780 GCCCCTCCCTCCTTCTTCCCTGG + Intergenic
903321565 1:22546552-22546574 CCCTTTCCTCCCTTCTTCCCAGG + Intergenic
904035647 1:27557209-27557231 GCCCTCCCTTCCTCCCTCCGAGG + Intronic
904629760 1:31832058-31832080 GCCCTTCCTTCCTCCATCTGGGG + Intergenic
906117326 1:43365522-43365544 CCCTTTCCTTCCTTCTTTCCCGG - Intronic
906279688 1:44544606-44544628 GCACTTCCCTCCTTCTCCGGAGG - Intronic
907841388 1:58160958-58160980 GCACTTCCTACCTTCTACTGTGG - Intronic
907940658 1:59084181-59084203 TTCCTTCCTTCCTTCTCCCCTGG + Intergenic
908769520 1:67583394-67583416 GCCCTTACTTTCTTCCTCAGAGG + Intergenic
910288604 1:85579749-85579771 GCCCTTCCCGCCTCCCTCCGCGG - Intergenic
912458364 1:109814848-109814870 GCCCTCACTTCCTTCATCCTAGG + Intergenic
912497456 1:110100699-110100721 CCCCTTCCTCCCTTCTCCCCTGG - Intergenic
912709370 1:111938891-111938913 GCCCTTCCTTCCTTTGTGTGAGG - Intronic
913049886 1:115108375-115108397 TCCCTTCCTTCATTCTCCCAAGG + Intergenic
914675502 1:149904697-149904719 GCCCTTGCTTCCCTGTTCCAGGG - Exonic
914718794 1:150272457-150272479 GGCTTTCCTTCCTTCCTCCAAGG - Intronic
915244021 1:154543758-154543780 GCCCTTCCTTTCCTCTGCCGTGG + Intronic
916702179 1:167308531-167308553 TCCCTCCCTTCCTCCTTCCCTGG + Intronic
916790001 1:168116661-168116683 GCCCTCCCTTCATCCTTCCCTGG + Intronic
917521447 1:175751232-175751254 GGCCTTCATTCCTTCTTCAGAGG - Intergenic
919019612 1:192087620-192087642 GCCTTCCCTTCCTTCTTCTCAGG - Intergenic
919592833 1:199526070-199526092 GCTATTGCTTCCTGCTTCCGGGG - Intergenic
919847390 1:201650392-201650414 GCCCCACCGTCCTTGTTCCGTGG - Intronic
920351701 1:205342319-205342341 GGCCTTCCATCCTTCTTACTGGG + Intronic
921005754 1:211091732-211091754 GCCCTGCCTACCTCCTTCTGTGG - Intronic
921185419 1:212665662-212665684 GCCCTCCCTTCCTCTTTCCCTGG + Intergenic
922183682 1:223256047-223256069 TCCCTTCCTCCCTCCTTCCCAGG - Intronic
922711814 1:227839838-227839860 GCACTTTCTTAATTCTTCCGAGG + Intronic
923504757 1:234595703-234595725 GCTCTTCCTGCCTCCTTACGAGG - Intergenic
923743453 1:236677718-236677740 CCGCTGCCTTCCTTCTTCCATGG - Intergenic
923760441 1:236837805-236837827 GCCCTTCCTTTCATCTTTCCTGG + Intronic
1062866033 10:855403-855425 GCCCTACATTCCCTCTTCTGAGG - Intronic
1064208954 10:13347752-13347774 GCCCTCCCTCCCTCCTTCCCCGG + Intronic
1064362460 10:14678293-14678315 TCCCTTCCTTTCTTCCTCGGTGG + Intronic
1065262308 10:23936651-23936673 ATCCTTCCTTGCTTCTTCCCAGG - Intronic
1066681227 10:37938358-37938380 GCCCTGCCTTCTTGCTTCCTTGG - Intergenic
1067473855 10:46553845-46553867 GCCCTTCCTTCCTTCTGAGCTGG - Intronic
1070579732 10:77710460-77710482 GCCCTTCCTACCTGCTGCCCCGG - Intergenic
1070786309 10:79164155-79164177 GGCCTTCTCTCCTTCTTCCCAGG + Intronic
1070914102 10:80141831-80141853 GCCCATCCTCCCTTCCTCCCTGG + Intronic
1070957458 10:80473876-80473898 GCCCCTCCTTCCATCCTCAGAGG + Intronic
1073888570 10:108070219-108070241 CTCCTTCCTTCCTTCTTGTGAGG + Intergenic
1074160085 10:110829844-110829866 CCCCTTCCTTCCTTCTACCCAGG + Intronic
1074377600 10:112952023-112952045 TCTCTTCCTTCCCTCTTCTGTGG + Intronic
1074399901 10:113133405-113133427 GCCCTTCCATCCTCCTTTTGAGG + Intronic
1074824680 10:117206248-117206270 ACCCTTCCTTGCCTCTTCCTTGG + Intronic
1075200744 10:120401898-120401920 GCCCTTCCATCTTTCTTCATTGG - Intergenic
1075715938 10:124555370-124555392 TCCCTTCCTCCCTTCCTCCAGGG - Intronic
1075721260 10:124588887-124588909 GCCCTTCCTTCCTCATTCCCAGG - Intronic
1075905829 10:126081241-126081263 GCTGTTCCATCCTTCTTCCTCGG - Intronic
1076076223 10:127535875-127535897 GCCCTTCCTTCCTCTAGCCGAGG - Intergenic
1076639650 10:131905643-131905665 GTATTTCCTTCCTTCTTCGGTGG - Intronic
1077268540 11:1664535-1664557 TCCCTTCCTTCCTTCCTCTCTGG - Intergenic
1077272339 11:1687083-1687105 TCCCTTCCTTCCTTCCTCTCTGG + Intergenic
1077483981 11:2830533-2830555 GCCCGCCCTTCCTGCTCCCGGGG - Intronic
1077613481 11:3659483-3659505 GCCCTTCCTGCCTTTCTCAGTGG + Intronic
1079357221 11:19739805-19739827 GCCGCTGCTTCCTTCTTCAGAGG - Intronic
1080200968 11:29669504-29669526 GCCCTTTCTGCCTGCTTCCAAGG + Intergenic
1080591173 11:33724155-33724177 TTCCTTCCTTCCTCCTTCCGTGG - Intronic
1083353559 11:62048331-62048353 TCCCTTCCCTCCCTCTTCCTAGG + Intergenic
1084069756 11:66726919-66726941 GCTGTTCCTTCCTTCTGCCCTGG - Intronic
1084195491 11:67522032-67522054 GCCCTTCCTTCTTGCTTCCCGGG + Intronic
1084317797 11:68355339-68355361 TCCCTTGCTCCCTTCTTCCTGGG - Intronic
1085529679 11:77183958-77183980 GCCATTTCTGCCTTCTTCCCAGG - Intronic
1085819587 11:79778035-79778057 ATCCTTCCTGCCTTCTTCAGGGG + Intergenic
1085845314 11:80058511-80058533 GACCTTCCTTTCTGCTTCCTCGG - Intergenic
1086358094 11:86026875-86026897 TCCCTTCCCTCCCTCTTCAGAGG + Intronic
1087715777 11:101607126-101607148 TCCCTGCCTTCATTCTTCCTGGG + Intronic
1088585437 11:111356641-111356663 TCCCTTCCTTCCTTCATTCCCGG + Intronic
1089174813 11:116540773-116540795 GCTGCTCCTTCCTTCTTCCTGGG - Intergenic
1089307623 11:117536447-117536469 GCCATTTTTTCCTTCTCCCGTGG - Intronic
1090080602 11:123609755-123609777 GCCCTCCCTTCCTCATTCCAGGG + Intronic
1091041252 11:132283986-132284008 TCCCTTCCTTCCTCCCTCTGAGG + Intronic
1091657616 12:2357001-2357023 GCCCATCCTTCCATCCTCCATGG + Intronic
1091882186 12:3988988-3989010 ACCCTGCCTTCCATCTTCTGGGG + Intergenic
1092498849 12:9025767-9025789 ACCCATCTTTCCTTCTTCCATGG - Intergenic
1093196084 12:16131194-16131216 ATCCTTCCTTGCTTCTTCCTAGG + Intergenic
1094665167 12:32512867-32512889 GCCCTTCCCTCTTTCTGCCAAGG - Intronic
1097240034 12:57568860-57568882 CCTGTTCCTTCCTTCCTCCGTGG + Intronic
1097293584 12:57941161-57941183 CCACTCCCTGCCTTCTTCCGGGG - Intergenic
1100689996 12:97029565-97029587 GCCCTTCCTGCCTTCTTTTTTGG - Intergenic
1102412344 12:112730793-112730815 GCTCTTGTTTCCTTCTTCAGTGG - Intronic
1103640425 12:122346943-122346965 TCTCTTCCTGCCTTCTTCCCTGG - Intronic
1104051831 12:125199994-125200016 TCCATTCTTTCCTTCTTCCATGG - Intronic
1104348370 12:128023183-128023205 GCCCTTCCTTTCTTCCTCCTTGG - Intergenic
1104362305 12:128145436-128145458 GCCTTTCATTCCCTCTTTCGGGG - Intergenic
1104926445 12:132316473-132316495 GACCTTGCTTCCTTCCTCCCTGG + Intronic
1105028607 12:132867092-132867114 TCCGCTCCTTCCTTCTTCAGAGG - Intronic
1105623119 13:22088023-22088045 GCCCTTGCTGTCTTCTTCCTGGG + Intergenic
1105631806 13:22176830-22176852 ACCCTTCCTTCTTTCTTACCTGG - Intergenic
1106455225 13:29921067-29921089 AGCCTTCTTTCCTTCTTCTGTGG + Intergenic
1107307095 13:39034353-39034375 GCCCTTCCTTCCATCTTTCCAGG + Intronic
1107615215 13:42159989-42160011 GCCCTTTCTTCCTTCTCCACAGG + Exonic
1107615884 13:42167632-42167654 GCCCTTCCTTTCCTCTGCTGAGG + Intronic
1107736587 13:43405412-43405434 GGCCTTCCTTCCTGCTTGCCAGG + Intronic
1111466770 13:88623337-88623359 TCCCTCCCTTCCTTCTTCTTGGG - Intergenic
1112639491 13:101256646-101256668 GACCTTGCTTCCTACTTCCTGGG + Intronic
1113401412 13:109997430-109997452 TCCATTCCTTCCCACTTCCGGGG - Intergenic
1113954425 13:114089557-114089579 GCCCTTTCCTCCTGCTTCCTGGG - Intronic
1117121706 14:52574741-52574763 GACATTTCTTCTTTCTTCCGTGG + Intronic
1117122535 14:52583759-52583781 GCACTTTCTTCCTTCTTCCCTGG + Intronic
1117543443 14:56770775-56770797 GCCCTGCCTTCCTCCTTGCCTGG - Intergenic
1118788885 14:69070682-69070704 GCCCTTCCTACCTACTTTAGAGG + Intronic
1118887583 14:69879588-69879610 TCCCTTCCTTCCTTCGCTCGGGG - Exonic
1119234104 14:73005268-73005290 GCCCTTCCTTCCCTCATCAAAGG - Intronic
1120613016 14:86665980-86666002 TCCCTTCCTTTCTTCTTTCCTGG - Intergenic
1120789011 14:88562513-88562535 GTTCTGCCTTCCTTCTTCCAGGG - Intergenic
1120993447 14:90397821-90397843 GCTCTCCCCTCCTTCTTCCCGGG + Intronic
1121505341 14:94472924-94472946 GCCCTTCCTGCCGGCTTCTGTGG - Intronic
1122156387 14:99752926-99752948 GCCCTGCCTTCCAGCTTCCTGGG - Intronic
1125071668 15:35562016-35562038 GCCCTTTCCTCCATCTTCCAAGG - Intergenic
1128061784 15:64739859-64739881 GCCTTTGCTTCCCCCTTCCGTGG - Intergenic
1128318972 15:66679626-66679648 GCCTTTGCTTCCTTCATCCTCGG + Intronic
1128432576 15:67611939-67611961 TCCCTTCCTCCCTCCTTCCTTGG + Intronic
1128578047 15:68789680-68789702 GCCCTGCCTTCATTCTTCACTGG + Intronic
1128987566 15:72231877-72231899 ACCGGTCCTTCCTTGTTCCGCGG - Intergenic
1129257309 15:74340953-74340975 GCACATCCTTCCTTCTTAGGCGG - Intronic
1131327334 15:91460813-91460835 GCCCTTCCATCCATCTTCCTGGG - Intergenic
1132173782 15:99691147-99691169 TTCCTTCCTTCCTTCTTTCTTGG - Intronic
1132246179 15:100297985-100298007 GCCCCTCCTTCCTTCCTTCCTGG - Intronic
1132912231 16:2319987-2320009 GCGTTTCCTTCCTTCTCCCGTGG - Intronic
1133882644 16:9797541-9797563 GCCTTTCCTTCATTCCTCCACGG + Intronic
1135835250 16:25819468-25819490 CCCCTTCCTTCCTAATTCGGTGG + Intronic
1136622751 16:31441247-31441269 GCCCTACCTACCTTCCTCAGGGG + Intronic
1139016250 16:62692437-62692459 GTCCTTCCTTCCTTCCTTCCTGG - Intergenic
1139300579 16:65942193-65942215 TTCCTTCCTTCCTTCTTTCCTGG - Intergenic
1139544841 16:67645297-67645319 GCCCTTCCTGCCTTCTTGGCCGG + Intronic
1139651447 16:68364128-68364150 GACCTTCCTTCCTCTGTCCGAGG - Intronic
1139807759 16:69583799-69583821 ACCCTTCCTTCCTTCTTTTCTGG - Intronic
1139921251 16:70461766-70461788 GCCCTCCCTTCCTCCTTCCTGGG + Intronic
1140228391 16:73097053-73097075 TCCCTCCCTTCCTTCTTTCGAGG + Intergenic
1141304830 16:82852437-82852459 GTCCTTCCTTCCTATTTCCATGG + Intronic
1141799576 16:86297731-86297753 TCCCTCCCTTCCTTCTCCTGTGG + Intergenic
1142121078 16:88386994-88387016 GCCCATCTTTCCTTCTACCCAGG - Intergenic
1142242131 16:88952390-88952412 GCCCTCCAATCCTTCTCCCGCGG + Intronic
1143388164 17:6544224-6544246 GGCCTCCCTTTCTTCTTCTGAGG - Intronic
1143655158 17:8289585-8289607 CCCGTTCCTTCCTCCTTACGGGG - Exonic
1144631615 17:16875779-16875801 GCCCTGCCTTCCTTTTTCTCAGG - Intergenic
1144793703 17:17877021-17877043 ACCCTTCCTTCCTTCTCCTCAGG + Intronic
1145270732 17:21403610-21403632 GCCCATCATTCCTTCTTGCTTGG + Intronic
1145308939 17:21690997-21691019 GCCCATCATTCCTTCTTGCCTGG + Intergenic
1145728308 17:27153968-27153990 TCCCTGCCTTCCTTCATCCTGGG + Intergenic
1145994286 17:29096666-29096688 GTCCTTCCTTCTTTCCTCCCTGG + Intronic
1146373719 17:32280911-32280933 GCCCTTGCTTTCATCTTCCTGGG + Intronic
1146915696 17:36676943-36676965 GCCCGTGCTGCCTTCTTCCCTGG + Intergenic
1147443540 17:40461735-40461757 CCCTTTCCTTCTTTCTTCTGTGG + Intergenic
1147558707 17:41496067-41496089 GCCCTTCCTTCCTCCCTGCCTGG - Intergenic
1149965080 17:61154181-61154203 TCCCTTCCTTCCTTCCTCAAAGG - Intronic
1150023435 17:61645125-61645147 TTCCTTCCTTCCTTCTTTCCAGG + Intergenic
1154309814 18:13258623-13258645 GTCCTTCCTTCCTTTTTACTGGG + Intronic
1157407845 18:47438488-47438510 TCACTTCCTCCCTTCTTCCTGGG + Intergenic
1157814555 18:50721395-50721417 GGCCTGCCTTCCTTCTCCCAAGG + Intronic
1159550044 18:69885466-69885488 GCCCTTCCTTCCTCCTTCTGAGG - Intronic
1159679947 18:71337104-71337126 GCCCTTCTTATCTTCTTCCCTGG + Intergenic
1160991113 19:1860719-1860741 GCCATTCCCTCCCTCCTCCGGGG + Intronic
1161169781 19:2807056-2807078 GCCCTTCCTTCCTCCTCCACTGG + Intronic
1161900166 19:7112600-7112622 GCTCTTCCTTCCTTCTCCAATGG + Intronic
1164691096 19:30211287-30211309 CCCCTTCTTTCCTTCTGCAGAGG + Intergenic
1165782596 19:38442766-38442788 CCCCTTCCTTCCTTCCTGCCTGG - Intronic
1168627813 19:57932970-57932992 GCCCTTGCCTCCTTCTCCTGTGG + Intronic
925625100 2:5834736-5834758 GCCCTTCCTTCCGTCCACTGGGG - Intergenic
927350424 2:22105793-22105815 TCCCTTCCTTCCTTCCTTCCTGG - Intergenic
928015607 2:27654105-27654127 GTCCTTCCTTCCTTCTTTTATGG + Intronic
929654416 2:43716207-43716229 CCCCCTCCTCCCTTCTTCCAGGG - Intronic
930190096 2:48449307-48449329 ACCCTACCTTCCTTCTTCTGAGG - Intronic
930713241 2:54569159-54569181 CCCGTTCCTTTCTTCTTCCCAGG - Intronic
930753063 2:54950598-54950620 GCTCTCCCTTCCTTCCTCTGAGG + Intronic
932176456 2:69607262-69607284 GCCCGTCCTTCCCTCTCCCTGGG - Intronic
932683573 2:73848656-73848678 GCCCTTCCACCCTTCTGTCGTGG - Intronic
933749517 2:85594203-85594225 TCCCTTCCTTCCTTTTTCGACGG + Intergenic
935934359 2:108165846-108165868 CCACTTTCTTCCTTCTTCTGTGG + Intergenic
936921734 2:117696079-117696101 GCCCTGCCTGCCTCCTTCCTGGG - Intergenic
936979910 2:118254841-118254863 GCCCTTCTTTCCATCTCCAGTGG - Intergenic
937018690 2:118630958-118630980 TCCCTTCTTCCCTTCTTCCCTGG - Intergenic
938593979 2:132767822-132767844 GTCCTTCCTCCATTCTTCCCCGG - Intronic
939077152 2:137617535-137617557 GCCCTTCCCTCTTTCTTTCCCGG + Intronic
939476300 2:142692416-142692438 GCCATTCTTTCCTTATGCCGAGG - Intergenic
939503566 2:143015616-143015638 GACATTCCTTCTTTCTTCCTGGG + Intronic
940768278 2:157813407-157813429 TCCCTTCTTTCCTTCTTCTTGGG + Intronic
943965367 2:194326172-194326194 GGCCTTCCTTCCAGCTTCCAAGG + Intergenic
945213601 2:207410090-207410112 TCCCTGCCTTCCTTCAACCGTGG + Intergenic
945845038 2:214933758-214933780 CACTTTCCTTCCTTCTTCCATGG - Intronic
948257569 2:236578985-236579007 GCCCTTTCTTCTTTCTTCTTAGG + Intronic
948786196 2:240354211-240354233 GCACTGTCTTCCTTCTTCCCAGG + Intergenic
948854887 2:240725458-240725480 GCCCTTCCAGCCTTCTCCTGGGG + Intronic
1168963138 20:1882281-1882303 GCCCTTGCTTACTTCTTCAGCGG - Intergenic
1169040758 20:2493529-2493551 GCCTTTCCCTCCTTTTTCTGGGG + Exonic
1169333916 20:4739499-4739521 GGCATTCTTTCCTTCTTCTGTGG + Intronic
1169569489 20:6890557-6890579 GCCCTTCCTTTCTTCGCCCCAGG - Intergenic
1169889316 20:10435282-10435304 GCGCTTACTTCCTCCTTCCCAGG - Exonic
1171542916 20:25978226-25978248 CCCCTGCCTTCCTTCATCCCAGG - Intergenic
1172215450 20:33232586-33232608 GCCTTTCCTTCCTGCTTCTCAGG - Intergenic
1173564059 20:44026816-44026838 GGGCCTCCTTCCTTCTTCTGTGG + Intronic
1173687050 20:44931090-44931112 TTCCTTCCTTCCTTCCTTCGTGG + Intronic
1173712651 20:45174429-45174451 GCATTTCCTTCCTTCTTCCCTGG - Intergenic
1175333398 20:58179663-58179685 GCATTTCCTTCCCTCTTCCGCGG - Intergenic
1177148643 21:17432723-17432745 TCCCTTCCTTCCTTCTTCTATGG - Intergenic
1179473223 21:41625989-41626011 TCCCTTTTTTCCTGCTTCCGGGG - Intergenic
1181010509 22:20037623-20037645 ACCCTTCCTTCCTGATTCCTTGG - Intronic
1183028232 22:35082509-35082531 GCTCTTCCTTCCTTCTGCATGGG - Exonic
1183367811 22:37416576-37416598 GCCCTTCCCTCCCACTTCTGTGG - Intronic
1184510781 22:44932001-44932023 GCCCTGCCTTCCTTCCTTCCTGG - Intronic
1185235718 22:49711786-49711808 TCTCTTCCTTCCTTTTTCCCTGG - Intergenic
950269036 3:11598489-11598511 TCCCTTCCTTCCTTTTTTAGAGG + Intronic
950796029 3:15511412-15511434 GCCCTTACTTCCCTCTGCTGTGG - Intronic
952935602 3:38396225-38396247 TCCCTCACTTCCTTCTTCCTGGG - Intronic
953244059 3:41174879-41174901 GCCCTCCCTTCCTGCTTCCCAGG - Intergenic
953381579 3:42476529-42476551 GCTCTTCCCTCCTTCTTCAAAGG + Intergenic
953982084 3:47418039-47418061 TCCCCTCCTTTCTTCCTCCGAGG - Intronic
954142959 3:48619795-48619817 GCTCTGGCTTCCTTCTTCCCAGG - Intergenic
956108137 3:65843269-65843291 GTCCTTGCTCCCTTATTCCGTGG - Intronic
959005876 3:101019309-101019331 GCCCTTGTTTCCTTCTTGCTGGG - Intergenic
961163427 3:124748621-124748643 GCCCTTCCTCCCTCCTTCCCTGG - Intergenic
961791866 3:129382092-129382114 GCCATTCCTTCCTCCATCTGAGG - Intergenic
961805889 3:129489051-129489073 GCCATTCCTTCCTCCATCTGAGG - Intronic
961827911 3:129608203-129608225 GCCCTTCCTTCCTGGTTGGGTGG - Intergenic
962382682 3:134910238-134910260 GCCCTCCCTTCCTCCTACAGTGG + Intronic
963077357 3:141359459-141359481 CCTCTTCCTTCCTTCTTGCTGGG - Intronic
964752510 3:160065427-160065449 GCCCTGCCTCCCTTCCTCCTCGG + Intergenic
965140145 3:164822703-164822725 TTCCTTCCTTCCTTCTTTCCAGG + Intergenic
966317383 3:178663165-178663187 GCCCTTTCTTACTCCTTCCTGGG - Intronic
967827210 3:193886832-193886854 ACCTTTTCTTCCTTCTTCCAAGG + Intergenic
967929094 3:194677738-194677760 TCCCCTCCTTCCATCTTCAGAGG + Intergenic
968556324 4:1248155-1248177 GCCCGTGCTCCCTGCTTCCGCGG + Intronic
968797743 4:2719793-2719815 TCCCTTCCTTCCTTCTGACAGGG + Intronic
969513274 4:7631779-7631801 GCCCTCCCTTCCCTCTTCACAGG + Intronic
970508518 4:16757032-16757054 GCTCTTCCTTCATGCTTCCAGGG - Intronic
971421913 4:26481599-26481621 TCCCTGCCTTCCTTCTGCGGTGG + Exonic
971922803 4:32965069-32965091 TTCCTTCCTTCCTTTTTCAGAGG + Intergenic
972309678 4:37868396-37868418 GCCCTTTCTGCCTGCTTCTGAGG - Intergenic
972974875 4:44621849-44621871 GCCCTCACTTCCTTCTTACTTGG - Intergenic
973932436 4:55806725-55806747 CCCCTTCCTCCCTTCTTCCTGGG - Intergenic
974483181 4:62472037-62472059 GTCCTCCCTTTCTTATTCCGGGG - Intergenic
975185684 4:71399504-71399526 TTCCTTCCTTCCTTCCTCCCTGG + Intronic
977119624 4:93082194-93082216 GCTCTTCCTTTCCTCTTCAGTGG + Intronic
978077330 4:104548984-104549006 GCCTTTCCTTCCTTCCACCCTGG - Intergenic
979715887 4:123837237-123837259 GCCCTTTCTTTGTTCTTCAGAGG - Intergenic
980577269 4:134699374-134699396 TTCCTTCCTTCCTTCTATCGGGG - Intergenic
980971664 4:139572842-139572864 TTCCTTCCTTCCTTCTGCAGTGG + Intronic
981538253 4:145822812-145822834 GCACATCCTTCCTTCTACCCAGG + Intronic
982115499 4:152095414-152095436 GCCCTCCCTTCCTTCTAGCCTGG - Intergenic
983387392 4:167082739-167082761 TCCCTTCCTTCCTTCCTTCCTGG - Intronic
986285258 5:6354328-6354350 GCCTCTGCTTCCTTCTTCTGAGG - Intergenic
986677701 5:10201375-10201397 GCCCCTCCTTTCTTCTTCCAGGG - Intergenic
988889507 5:35599328-35599350 GCTCTTGTTTCCTTCTTCCTGGG - Intergenic
991248022 5:64528510-64528532 GCCTATCCTTCCTTTTTCAGGGG - Intronic
991396675 5:66211272-66211294 GCCTTTCTCTCCTTCTTCCATGG - Intergenic
992489494 5:77228426-77228448 GCTCTTCCTTCATGCTTCCATGG - Intronic
995947697 5:117669668-117669690 TCCCTTCAGTCCTTCTTCTGTGG + Intergenic
999748924 5:154611696-154611718 GCCCCGCCTTCCTTCTCACGAGG + Intergenic
999774397 5:154800437-154800459 CCTCTCCCTTCCTTCTTCTGAGG - Intronic
1000713121 5:164605807-164605829 GCCCTTCATTCTTTCTTCTTTGG + Intergenic
1000989216 5:167894914-167894936 TTCCTTCCTTCCTTCTTTCCAGG - Intronic
1001408699 5:171495269-171495291 TTCCTTCCTTCCTTCCTCTGTGG - Intergenic
1002579600 5:180199704-180199726 CTCCTTCCTTCCTTCTTTCCCGG + Intronic
1002892730 6:1350017-1350039 TCCCTTTCTTCCTTCTTCAGTGG - Intergenic
1003029749 6:2592038-2592060 TCCCTTCCTTCCTTCATAGGTGG + Intergenic
1003644614 6:7904555-7904577 CCCCTTCCTTCCAACTTACGTGG + Exonic
1004453507 6:15769778-15769800 TCCCTCCCTTCCTTCTTTCATGG + Intergenic
1005335621 6:24793291-24793313 GCTCTTCCCTTCTTCTTCTGGGG + Intergenic
1016358102 6:143239520-143239542 GTCCTTCCTACATTCTTCAGGGG - Intronic
1017626958 6:156358646-156358668 TCCCTTCCTTCTCTTTTCCGAGG - Intergenic
1018394659 6:163368951-163368973 CTCCTTCCTTCCATCTTCAGGGG - Intergenic
1019781071 7:2940036-2940058 GCCCCTCTCTCCTTCTTCCACGG + Intronic
1022033616 7:26514421-26514443 CCCCTGCCTTCCCTCTTCCCTGG + Intergenic
1022123119 7:27329287-27329309 GCTCTTCCATCCTCCTTGCGTGG + Intergenic
1022369632 7:29758377-29758399 GCCCTTCCTTGCTTTTTCCTTGG - Intergenic
1023257775 7:38329137-38329159 GCCCTTCTTTCCTAATTCAGAGG + Intergenic
1024984564 7:55183837-55183859 GCCCTTCCTCCGTTCATCAGAGG + Intronic
1025242969 7:57293433-57293455 GCCAATCCTTCCTTCTCCCCTGG - Intergenic
1025294298 7:57763334-57763356 CCCCTGCCTTCCTTCATCCTGGG - Intergenic
1026898768 7:74025954-74025976 CCCCTGCCTTCCTCCTTCCCAGG + Intergenic
1027180448 7:75935584-75935606 TCCCTTCCTGCCTTTTTCCAAGG + Intronic
1029110018 7:98208980-98209002 GCGCTGCCTTCCTTCCACCGGGG - Exonic
1029180641 7:98699017-98699039 TCCCTTCCTTGCTTCTTCCTTGG + Intergenic
1029459929 7:100688604-100688626 CCCCTGCCCTCCTTCTTCCCGGG - Exonic
1029478166 7:100797472-100797494 GCCCTTCCTCTCTCCTTCCCAGG - Intronic
1031718903 7:125143978-125144000 TCCCTTCCTTGCCTCTTCCATGG + Intergenic
1032322609 7:130898420-130898442 GCCCTTCCTTCCACCTTCAAAGG + Intergenic
1033442189 7:141390218-141390240 GACCTTCCTTCCTTCTTTCCTGG + Intronic
1034293418 7:149950007-149950029 GCACTTCCTCCCTGCTCCCGTGG - Intergenic
1034343050 7:150370106-150370128 CTGCTTCCTTCCTCCTTCCGCGG + Intronic
1034472450 7:151262669-151262691 GCCCCTCCTCCCTGCTCCCGCGG - Intronic
1034812648 7:154146846-154146868 GCACTTCCTCCCTGCTCCCGTGG + Intronic
1035534864 8:383310-383332 GCCCTGCGTTCCTGCTTCCCTGG - Intergenic
1035646948 8:1231798-1231820 GCCCTTCCTTCCTCCTCTAGCGG - Intergenic
1035856976 8:2986036-2986058 TTCCTTCCTTCCTTCTTCTATGG - Intronic
1035864275 8:3065006-3065028 GCCCATGCTTCCTTCTCCAGTGG + Intronic
1036203895 8:6791423-6791445 GTCCTCCCTCCCTTCCTCCGTGG - Intergenic
1036689973 8:10939217-10939239 TTCCTTCCTTCCTTCTTGCCTGG - Intronic
1037474630 8:19244984-19245006 GTCCTTCCTTCCTTCTCAGGAGG - Intergenic
1037779504 8:21858119-21858141 GCCCATCCTTCCTTCTTTGAGGG - Intergenic
1037892186 8:22629245-22629267 GCACTTCCTTGCCTCTTCTGCGG - Intronic
1038164041 8:25067702-25067724 GCCCTTGCTTCCTCCTGCTGTGG + Intergenic
1039109031 8:34021640-34021662 ACCCTTGCTTCCTACTTCCAGGG + Intergenic
1042501856 8:69517143-69517165 GCCCTTCCACCCTTCTGCCATGG - Intronic
1044838081 8:96315017-96315039 CCCCTTCCCTCCTTGTGCCGGGG + Intronic
1045266357 8:100621877-100621899 GCCCTTCCTTCCTTCTTCCGAGG - Intronic
1045359789 8:101422280-101422302 TTCCTTCCTTCCTTCTTCAGGGG - Intergenic
1045404021 8:101847362-101847384 GCCCTTCCCTTCTTCTTTAGTGG + Intronic
1046330064 8:112702570-112702592 GCACTTCTTTCCTACTTCCGGGG + Intronic
1048477612 8:134757314-134757336 GCCCTTCCTTCCTTCTTTAGAGG + Intergenic
1049190464 8:141284762-141284784 GCCCTTCAGTCCTTCTTCATGGG - Intronic
1049345969 8:142138820-142138842 GCCCTTCCATCCTCCTTTCCAGG - Intergenic
1049505188 8:142992377-142992399 CCCCTTCCTTCCTGCTTGCAGGG - Intergenic
1049743413 8:144251927-144251949 GCCCATCCTTCCTCCTTGCCAGG + Intronic
1050180363 9:2916477-2916499 TTCCTTCCTTCCTTCCTCCATGG + Intergenic
1050568571 9:6913661-6913683 GCCTTTCCTTCCTTCTTATCAGG + Intronic
1051056605 9:12994834-12994856 ACCCTTCCATCCCTCATCCGAGG + Intergenic
1053416683 9:37951241-37951263 GCTCTTCCTGCCTTCTCCCCTGG - Intronic
1054927930 9:70606894-70606916 GCTCTTCCTCACTTCTTCCTGGG + Intronic
1054945556 9:70792416-70792438 CCACTTCCTTCCCTCTTCCTGGG - Intronic
1055660829 9:78502458-78502480 GCTCTCTCTTCCTTCTTCCTTGG - Intergenic
1056775387 9:89508605-89508627 GCACATCCTCCCTTCTTCCTCGG + Intergenic
1057385768 9:94604849-94604871 GCCCTGCTTTCCTTCTGCCAGGG - Intronic
1058948940 9:109885285-109885307 TCCATTCCTTCCTTCTTCGTGGG - Intronic
1058952597 9:109917433-109917455 GCCTTTCCTTCCTTCCTGCCAGG - Intronic
1059934114 9:119290678-119290700 GCCCTTCCCTCCATTTTCCCTGG - Intronic
1060813250 9:126621990-126622012 GCCCTTCCTTTGTTATTCCCTGG + Intronic
1060861826 9:126960987-126961009 GCCCTTCCTTACCTCTTGCCTGG + Intronic
1061264395 9:129496991-129497013 CTCCTTCCTTTCTTCTTCCTGGG - Intergenic
1061404536 9:130386073-130386095 GCCCTCCCTCCCTCCTTCCGTGG + Intronic
1061462568 9:130751968-130751990 GCCATTCCATCCTCCTTCCAGGG - Intronic
1062075061 9:134583436-134583458 GCGCTGCCTTCCTTCCACCGGGG + Intergenic
1062329313 9:136030172-136030194 GCCCTTCCTTGCTTTTTCAAAGG + Intronic
1062340102 9:136090342-136090364 GGCCTTCCTTGGTTCTTCTGCGG - Intronic
1062520399 9:136955294-136955316 GCCCTCCCTTGCTTCCTCCTGGG + Intronic
1186258120 X:7744923-7744945 ACCCATCCTTCCTCCTTCCATGG + Intergenic
1186266165 X:7836290-7836312 GACCTTCCTTCCTTCCTCTGAGG - Intergenic
1186768623 X:12795567-12795589 GCCCTTCCACCCTTCTGCCATGG - Intronic
1186930970 X:14389708-14389730 GCCTTTCTTTTCTTCTTCCTGGG + Intergenic
1187986566 X:24819800-24819822 CCCCTTCCTCCCTACTTCCCCGG + Intronic
1189073901 X:37895539-37895561 TTCCTTCCTTCCTTCTTCTGAGG + Intronic
1189400939 X:40667925-40667947 GCCCTTCCTTCCTGCTACTTGGG - Intronic
1190275255 X:48895100-48895122 GCCCTTCCTTCCTTTCCCCAGGG - Exonic
1196007790 X:110854014-110854036 CCACTTCTTTCCTTCTTCCTAGG - Intergenic
1198963415 X:142205057-142205079 GCACCTCCTCCCTTCTTCTGGGG + Intronic
1199695755 X:150341779-150341801 TCCCTCCCTTCCTCCTTCCCAGG + Intergenic
1199816530 X:151402702-151402724 GCCCTGCCTACCTCCTTCAGTGG + Intronic
1200153759 X:153964422-153964444 GTCCTTGCTGCCTTCTTCTGAGG + Intronic
1200750271 Y:6938493-6938515 GCCCTTTCTTCCATCTGCAGAGG + Intronic
1201452836 Y:14135004-14135026 GGCATTCCTTCCTTCCTCTGAGG + Intergenic
1201554387 Y:15253635-15253657 CTCCTTCCTTCCTTCTTTCTTGG + Intergenic