ID: 1045266363

View in Genome Browser
Species Human (GRCh38)
Location 8:100621905-100621927
Sequence AGCAGCCCCAGCTGAAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045266363_1045266365 -6 Left 1045266363 8:100621905-100621927 CCTCGCCTTCAGCTGGGGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 265
Right 1045266365 8:100621922-100621944 GCTGCTAATCTTGAAGCAAATGG No data
1045266363_1045266366 -3 Left 1045266363 8:100621905-100621927 CCTCGCCTTCAGCTGGGGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 265
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data
1045266363_1045266367 -2 Left 1045266363 8:100621905-100621927 CCTCGCCTTCAGCTGGGGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 265
Right 1045266367 8:100621926-100621948 CTAATCTTGAAGCAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045266363 Original CRISPR AGCAGCCCCAGCTGAAGGCG AGG (reversed) Intronic
900667687 1:3826398-3826420 AGCAGCCCCTGCTGAAGCTCTGG - Exonic
901838563 1:11939463-11939485 AGCAGTCCCAGCCCAAGGCGTGG - Intronic
903679984 1:25090001-25090023 ATCAGCTCCAGCTGCAGGAGGGG + Intergenic
903888655 1:26555629-26555651 AGCAGCCCCAGCTCAGGGGAGGG + Intronic
904566993 1:31434184-31434206 GGCTGCCTCAGCTGAAGTCGCGG - Exonic
905205687 1:36341694-36341716 TCCAGCCCCAGCCAAAGGCGTGG - Exonic
906534657 1:46544748-46544770 AGCAGGCCCACCTCAAGGCTGGG + Intergenic
908102700 1:60807864-60807886 AGCAGCAGCAGCTGCAGGCAGGG + Intergenic
908193346 1:61725432-61725454 AGAAGCCTCAGCTAAGGGCGCGG - Intergenic
910569540 1:88684425-88684447 CGCAGCCCCTGCTGGAGGCGCGG - Exonic
911301343 1:96178285-96178307 AGCAGCCCCAGCAAAACGGGTGG - Intergenic
915073961 1:153293955-153293977 AGCAGCCCACGGTGAAGGAGGGG - Intergenic
916533417 1:165680237-165680259 AACAGCCCCAGCCTAAGGAGAGG - Intronic
919913555 1:202126673-202126695 AGCAGCCCGAGCGGCAGGGGAGG - Intronic
922500704 1:226095048-226095070 ATCAGGCCCAGCTGAAGAGGTGG - Intergenic
922572662 1:226643128-226643150 AGCAGCTCCAGCTGAACTGGCGG + Intronic
923272365 1:232369400-232369422 AGCAGCAAGAGCTGCAGGCGAGG + Intergenic
923926184 1:238629779-238629801 AGCAAGCCCAGATGATGGCGGGG + Intergenic
924415853 1:243855909-243855931 AGGAGCGCCAGCTGAAGGTAAGG - Intergenic
924431423 1:244000498-244000520 GGCAGCCCAACCTGAAGGAGCGG - Intergenic
1062862097 10:818181-818203 AGCAGGGGCAGCTGAAGGCAAGG + Intronic
1065521706 10:26579838-26579860 AGCAGGGCCAGCTGAGGGTGCGG + Intergenic
1065608039 10:27441380-27441402 ACCAGACCCAGGTGAAGGCAAGG + Intergenic
1066244829 10:33572215-33572237 AGCAGCCCCAGTCTAAGGAGAGG + Intergenic
1066385860 10:34940643-34940665 AGCTGACCCCGCTGAAGGCTGGG + Intergenic
1066986846 10:42475788-42475810 AGGAGGCGCAGCGGAAGGCGAGG - Intergenic
1067285599 10:44905533-44905555 GGCAGCCCCAGCTGACAGCATGG - Intergenic
1067722883 10:48743074-48743096 AGGAGCCCCCGCTGCAGGCATGG + Exonic
1070312037 10:75280993-75281015 AGCAGAGCCAGCTGGAGGAGAGG + Intergenic
1073435987 10:103516378-103516400 AGGACCCCAAGCAGAAGGCGGGG + Intronic
1075585123 10:123651864-123651886 AGCTGCCCCAGCTGCAGCCCAGG - Intergenic
1076603027 10:131671221-131671243 AGCAACCCCAGCCCAAGGCAGGG - Intergenic
1077013769 11:391174-391196 AGCTGCCCCAGCCACAGGCGCGG + Intergenic
1078040193 11:7854022-7854044 AGCATCCCCAGCTGAGGGTGAGG - Intergenic
1080682244 11:34487667-34487689 AGCAGCATCAGCAGAAGGAGGGG - Intronic
1083782779 11:64926646-64926668 AGCTGCCCCAGCTGTGGGTGGGG - Intronic
1084008462 11:66335172-66335194 TGTTGCCCCAGCTGAAGGCCCGG - Exonic
1084287687 11:68142525-68142547 AGCAGCCCCAGGAGAGGGAGGGG - Intergenic
1084555567 11:69873928-69873950 TGCAGGCCCAGCTCAAGGTGTGG + Intergenic
1084859762 11:72010780-72010802 AGCAGCAGAAGCTGAAGGTGGGG - Exonic
1085246877 11:75108898-75108920 AGCAGGCCTAGCTGAAGGGAAGG - Intronic
1085261697 11:75209308-75209330 TGGAGACCCAGCTGAAGGTGTGG + Intergenic
1085505820 11:77058235-77058257 AGCAGCCCCAGGTGCCGGCTTGG + Intergenic
1086397452 11:86431555-86431577 AGCAGCCGCAGCCGCAGTCGTGG - Intergenic
1088640111 11:111864297-111864319 AACAGCCCCGGCTGGAGGCCAGG + Intronic
1088916677 11:114232835-114232857 AGCAGCACCCGCTGGGGGCGAGG - Intronic
1089476438 11:118766872-118766894 AGCAGCAGCAGCAGAAGGCCAGG - Intronic
1089689617 11:120179195-120179217 AGCAACCCAAGCTGGAGGCGTGG + Intronic
1090984841 11:131757039-131757061 GGCTGCCCCTGCTGAAGGCATGG - Intronic
1091271178 11:134312974-134312996 AGCAGCACCAGCAGCAGGGGTGG - Intronic
1091774314 12:3174546-3174568 AAAAGCCACAGCTGAAGGCCAGG - Intronic
1091975094 12:4817958-4817980 AGCAGCGCCAGCAGACTGCGTGG - Intronic
1092273753 12:7043609-7043631 AGCAGCCCATGCTTAAGGAGTGG + Intronic
1092865762 12:12759680-12759702 GGCAGCCCGAGCTGCAGACGGGG - Intronic
1093884776 12:24447132-24447154 AGCAGCCCCTGCTCAAGAGGAGG - Intergenic
1095463480 12:42466242-42466264 AACAGCCACAGCAGAAGGGGCGG + Exonic
1095603112 12:44037248-44037270 TCCAGCCACAGCTGCAGGCGAGG + Intronic
1095901036 12:47328317-47328339 TGCATCCCCAGCTGATGGTGAGG + Intergenic
1100289277 12:93198665-93198687 AGCAGGACCTGCAGAAGGCGAGG + Intergenic
1100569394 12:95832804-95832826 AGCAGACCCAGCAGAGGGCAGGG + Intergenic
1102525996 12:113512663-113512685 GGCAGCCCCACCTGGAGGTGGGG - Intergenic
1103096579 12:118136903-118136925 GGCAGCCCCAGCCGTGGGCGTGG - Intronic
1103134455 12:118495835-118495857 AGCATCCACAGCTGAAGTGGGGG - Intergenic
1104035085 12:125092322-125092344 AGCAGCACCAGCTGCAGGTGTGG + Intronic
1104080909 12:125429914-125429936 TGCAGCCCACGCTGAAGGGGTGG + Intronic
1104918632 12:132279123-132279145 AGCAGCCCCAGCAGAAACCTGGG - Intronic
1104932049 12:132345084-132345106 AGCAGCCCCAGGTACAGCCGCGG + Intergenic
1105410553 13:20168045-20168067 CCCAGCCCCCGCTGAAGGTGAGG - Intergenic
1106906428 13:34414247-34414269 AGCTGCCCCAGCTGCAGTCCAGG - Intergenic
1107886337 13:44877130-44877152 AGCTACGCCAGCTGCAGGCGTGG + Intergenic
1107958884 13:45542072-45542094 AGGAGCCCAAGGTGGAGGCGGGG - Intronic
1115058560 14:29162300-29162322 AGCAGCACCAGCAGAAGGGAAGG - Intergenic
1118973737 14:70659525-70659547 AGCAGCCGCAGCAGGAGGAGGGG + Intronic
1121778428 14:96606312-96606334 AGCCGCCCCAGCTGACTGCATGG + Intergenic
1122264867 14:100541828-100541850 AGCAGCCGCAGCTGCTGGCTCGG + Intronic
1122362647 14:101176481-101176503 AGCAGGCCAAGCTGATGGCAGGG - Intergenic
1122718077 14:103707187-103707209 AGCTGCACCAGCAGAAGGAGCGG - Exonic
1122905030 14:104797659-104797681 AGCAGTCCCAGCAGCAGCCGTGG - Intergenic
1123003866 14:105312069-105312091 AGCAGGCCCTGCTGAAGTCGGGG - Exonic
1123102730 14:105816495-105816517 AACAGCGCCAGCTGAGGGTGTGG - Intergenic
1124199412 15:27665258-27665280 ACCAGCCACAGATGAAGGCCAGG - Intergenic
1124606085 15:31171284-31171306 AGCAGCCCAAGCTGATGACACGG - Intergenic
1125445622 15:39752331-39752353 TGCAGCCCCTGCTTAAGGAGTGG - Intronic
1125729707 15:41886259-41886281 AGCAGATGCAGCTGGAGGCGCGG - Exonic
1129530648 15:76261623-76261645 AGCAGCCCCAGCTGCTGTGGCGG + Intronic
1131097988 15:89667825-89667847 AACTGCCCCTGCTGAAGGCCAGG + Intronic
1132057489 15:98663232-98663254 AGCAGTCCCAGTTGATGGAGAGG + Intronic
1132558563 16:583384-583406 AGCAGCCCCAGGTGGAGGGCTGG + Exonic
1133116401 16:3580209-3580231 AGCAGCCCCAACTGAATCCAAGG + Intergenic
1135433385 16:22406698-22406720 AGCAGTCCCAGCTGAGGCTGAGG + Intronic
1137023346 16:35451647-35451669 CGCCACCCCAGCTGAAGGTGGGG + Intergenic
1137375697 16:47949963-47949985 TGCAGCCCCATCTGGAGGCCCGG + Intergenic
1138426016 16:56932431-56932453 GGCATCCCCAGCAGAGGGCGGGG - Intronic
1139327591 16:66164233-66164255 TGCCCCCTCAGCTGAAGGCGAGG - Intergenic
1140450287 16:75065160-75065182 GGCAGCCAGAGCTGAAGACGAGG + Intronic
1142029050 16:87829404-87829426 CGCAGTCCCAGCTGAACGGGAGG - Intergenic
1142375067 16:89702255-89702277 AGCAGCCTCAGGTGGATGCGGGG + Intergenic
1143356038 17:6329327-6329349 ACCAGCCCCAGCTCATGGCAGGG + Intergenic
1143387572 17:6540999-6541021 GGCAGCCCCTGCTGGAGGGGAGG - Intronic
1146061053 17:29607631-29607653 AGCAGCCCCAGCAGGGGGTGGGG + Intronic
1147540116 17:41350414-41350436 AGGAGCTCCAGCAGAAGGTGAGG - Exonic
1147542132 17:41369397-41369419 AGGAGCTCCAGCAGAAGGTGAGG - Exonic
1147543668 17:41381893-41381915 AGGAGCTCCAGCAGAAGGTGAGG - Exonic
1147547213 17:41411341-41411363 AGGAGCTCCAGCAGAAGGTGAGG - Intergenic
1147548855 17:41424026-41424048 AGGAGCTCCAGCAGAAGGTGAGG - Exonic
1147554329 17:41466852-41466874 AGGAGCTCCAGCAGAAGGTGAGG - Exonic
1147585965 17:41654232-41654254 AGCTGGCTCAGCTGCAGGCGGGG + Intergenic
1147817503 17:43220811-43220833 ACCAGCCCAAGGTGAAGGAGTGG - Intergenic
1148021691 17:44557710-44557732 AGCAGCGGCAGCAGCAGGCGGGG - Exonic
1148150649 17:45394945-45394967 AGCAGCCCACACTGAAGGCTGGG + Exonic
1148684813 17:49495454-49495476 AGCAGCAACAGCAGCAGGCGCGG - Exonic
1150481846 17:65516944-65516966 AGCAGACCCTGGTGGAGGCGTGG - Intergenic
1151666717 17:75549502-75549524 AGCAGCCCCTGCGGAGGGCCAGG + Intronic
1151850885 17:76688905-76688927 AGCAGCCCCAGCTGATCCCATGG + Intronic
1152022973 17:77790745-77790767 GGCAGGCCCAGGTGAAGGTGTGG + Intergenic
1152882020 17:82823111-82823133 AGCAGCTCCAGCTGAGGTCTAGG + Intronic
1155312151 18:24534504-24534526 AGCCTCCCGATCTGAAGGCGGGG - Intergenic
1155318685 18:24597039-24597061 ACCAGGCCCAGCTGAAAGTGGGG - Intergenic
1156020627 18:32595846-32595868 AGCAGCCCCAGCAGGAGAGGTGG + Intergenic
1159093131 18:63871670-63871692 AGCATTCCCAGCTGAAAGCAGGG + Intronic
1159776877 18:72612825-72612847 AGCAGCCCCAGCTGGGAGCTGGG - Intronic
1161560654 19:4970730-4970752 TGCAGCCCCTGCTGAAGCAGTGG + Intronic
1161620204 19:5293412-5293434 GGGAGCCCCATCTGGAGGCGCGG + Intronic
1161975625 19:7606532-7606554 AGCAGCCCCTGCAGACGGGGCGG + Exonic
1163264258 19:16208851-16208873 AGCAGCCCCAGGTGAACCAGAGG + Intronic
1164290456 19:23863958-23863980 AGCAGCCCCAGATGTAGATGTGG - Intergenic
1164552701 19:29224828-29224850 AGCAGCCCCTGGTGATGGCCTGG + Intergenic
1166296536 19:41892747-41892769 AGCTGGCCCAGCTGGAGGCTTGG + Exonic
1166560820 19:43731410-43731432 AACAGCCCCAACTGAGGGTGGGG + Exonic
924960576 2:30794-30816 ACCAGACCCAGCAGAAGGCAAGG - Intergenic
925027458 2:621109-621131 AGCAGGCCGACCTGAGGGCGTGG - Intergenic
925163696 2:1703548-1703570 GGCAGCTCCAGGTGAAGGTGGGG + Intronic
925164049 2:1704648-1704670 GGCAGCTCCAGGTGAAGGGGGGG + Intronic
925361122 2:3280986-3281008 AGCACCCCAAGCTGGAGGCCAGG - Intronic
926151489 2:10428032-10428054 AGAAGGCCCAGCTGAAGAAGTGG + Intergenic
927062492 2:19436926-19436948 ACCAGGCTCAGCTGAAGGCAGGG + Intergenic
927469165 2:23359478-23359500 AGCAGCCACAGCTGAAGGACAGG + Intergenic
927736357 2:25526056-25526078 AGGAGCCCCAGGTGGAGGCAGGG + Intronic
927801179 2:26101323-26101345 AGCAGCCACAGCTGGAGCCTGGG + Intronic
928071864 2:28225136-28225158 AGCAGCACCAGCTGAGAGCAGGG - Intronic
928464965 2:31515008-31515030 AGCAGCCCAGCCTGAAGGCCTGG + Intergenic
929435969 2:41928667-41928689 AGCAGCCTCTGCTGAAAGCCGGG + Intergenic
929653721 2:43708132-43708154 AGCAGCTCCAGTTGAAGCCGAGG - Intronic
929805090 2:45138200-45138222 TGCAGGCCCATCTGAGGGCGGGG + Intergenic
932335820 2:70930888-70930910 ACCTGCCCCAGCTCCAGGCGAGG + Intronic
937116016 2:119405428-119405450 ACGAGCCCCAGCAGAAGGCATGG - Intergenic
937278045 2:120698673-120698695 AGCAGCTCCAGCTCAAGTCCTGG + Intergenic
937318032 2:120944381-120944403 AGCTGCCCCACCTGCAGGCAAGG + Intronic
937931683 2:127210104-127210126 AGCAGCCACAGAGGAAGGCCAGG + Intronic
938145960 2:128835172-128835194 AGCTGCCCCAGCTGAACCCCGGG + Intergenic
939991063 2:148876639-148876661 AGCAGCCCCAGCTGCAGAGAGGG - Intronic
940901647 2:159131444-159131466 AGCAGGCCCATCGGAAGGCAGGG - Intronic
941904275 2:170706037-170706059 AGCACCCCTAGATGGAGGCGGGG - Intergenic
942560428 2:177213046-177213068 TGCAGCCGAAGGTGAAGGCGAGG - Intronic
945298297 2:208192621-208192643 AGCAGCCTCAGCTGGGGGCAGGG - Intergenic
945366912 2:208965742-208965764 ATCAGCCCCACCTGATGGAGAGG - Intergenic
948732634 2:239976734-239976756 AGGAGCCACAGCAGAAGGCGAGG + Intronic
1171167388 20:22983989-22984011 AGCCGCCCCCGCTCAAGGGGTGG + Intergenic
1172047360 20:32089974-32089996 AGCAGGCCCAGCTGAGGCCCAGG - Intronic
1172619468 20:36309496-36309518 TGCAGACCCAGCTGGAGGCCAGG - Intronic
1175354709 20:58355266-58355288 AGCAGGCCCAGGTGAAGCCTTGG + Intronic
1175489345 20:59368932-59368954 AGCATTGCCAGCTGAAGACGGGG - Intergenic
1175657755 20:60786827-60786849 AGCAGTCCCAGCTGACCGCACGG - Intergenic
1178187966 21:30245358-30245380 AGGAGCACCAGCTGAAAGCCTGG - Intergenic
1178599837 21:33985912-33985934 AGCACCCCCAGCGGAAGCCAGGG - Intergenic
1179119175 21:38527292-38527314 AGCAGCCTCAGCTGCAGCTGGGG + Intronic
1179466738 21:41580937-41580959 GGCAGCGCCAGCAGAAGGCCAGG - Intergenic
1179887164 21:44319098-44319120 AGCAGCTCCAGCTCCAGGCAGGG - Intronic
1179961916 21:44772434-44772456 AGCAGACCCAGCAGAGGGCCAGG - Intronic
1179986079 21:44920900-44920922 AGAAACCTCAGCTGGAGGCGCGG + Exonic
1180058264 21:45370928-45370950 AGAAGCCCCAGCTGACAGCCAGG + Intergenic
1182712917 22:32333666-32333688 AGCAGCCCCAGCATCAGGGGCGG - Intergenic
1182804415 22:33058214-33058236 AGCAGCCCCCGCTCGAGGTGGGG + Intronic
1183096333 22:35554370-35554392 AGCAGCCCCAGCCCCAGGCTTGG - Intergenic
1183776791 22:39971375-39971397 AGCAGTGACAGCTGAAGGCCAGG - Exonic
949625125 3:5857147-5857169 TGCAGTCCCAGCTGAAGCTGAGG + Intergenic
953744713 3:45565480-45565502 GGCAGTCCCAGCAGAAGGGGTGG + Intronic
953788862 3:45931145-45931167 AGAAGACCCAGCTGATGGTGAGG + Exonic
954069349 3:48131452-48131474 AGCAGCCGCAGCAGCAGGCCCGG - Intergenic
954370783 3:50168674-50168696 AGGAGCCCCAGAGGAAGGCCTGG - Intronic
954397328 3:50299636-50299658 GGCAGAGCCAGCTGGAGGCGGGG - Intergenic
954792311 3:53142472-53142494 AGCACCCCCAGGGGAAGGCATGG - Intergenic
954803202 3:53199320-53199342 AGCCGCCCCAGCCGAGGGTGGGG + Intergenic
960198910 3:114807432-114807454 AGCAGCAGCAGCTGCAGGGGAGG - Intronic
961431942 3:126889806-126889828 AGCAACCCCAGCAGATGGCCTGG + Intronic
961597029 3:128025989-128026011 CTCAGGCCCAGCTGAAGGCAGGG + Intergenic
962500879 3:135990933-135990955 AGGAGCCAAAGCTGAAGGAGTGG - Intronic
967937846 3:194743279-194743301 AGCTTCCCCAGCTGAAAGCGGGG - Intergenic
968372939 4:11866-11888 AGCGGCCCCTGCTGGCGGCGGGG + Intergenic
968453239 4:684758-684780 GGCAGCCCCGGCAGAGGGCGGGG + Exonic
968658589 4:1789434-1789456 AGCAGCCCCAGCCCTAGGCCAGG + Intergenic
970043261 4:11820749-11820771 AGCAGCCCTGGCATAAGGCGAGG - Intergenic
970440070 4:16073070-16073092 AGCAGAGCCAGCTGAATGGGAGG - Intronic
971427237 4:26528502-26528524 TGCAGCCACACCTGAAGGTGTGG - Intergenic
973633115 4:52838073-52838095 AGCAGCCCCAGCTGCTGGTGAGG + Intergenic
974811579 4:66953020-66953042 AGCAGACCCACCTGAGGGTGAGG + Intergenic
976164876 4:82244032-82244054 TGCAGTCTCAGCTGAAGGCTTGG + Intergenic
976562851 4:86521774-86521796 ACAAGCCACAGCTGATGGCGTGG - Intronic
979930741 4:126627442-126627464 AGCAGCCCCATCTAGAGGCCTGG - Intergenic
979948210 4:126860496-126860518 AGCTGCTCCAGCTGCAGCCGTGG - Intergenic
982053920 4:151528833-151528855 TGTAGCCTCAGCTGAAGGGGGGG - Intronic
983455024 4:167952948-167952970 AGCAGCCCCTCCTGGAGGCCTGG + Intergenic
986869633 5:12031276-12031298 AGCAGCCCAAGCTGTATCCGGGG - Intergenic
986994926 5:13596234-13596256 AGCATCCCAAGCTGAAGCTGGGG + Intergenic
987389161 5:17359977-17359999 AGCAGCTCCAGCAGAAGCCCTGG - Intergenic
987967361 5:24893653-24893675 AGCAGCTCCAGCTCTAGGCATGG - Intergenic
989129778 5:38095426-38095448 AGCAGCTCCAGCAGAGGCCGTGG + Intergenic
989608892 5:43272870-43272892 AGCTGCCCCAGTGGAAGGGGTGG - Intronic
990635403 5:57720668-57720690 AGCAGCCCCAGCTGCTGAGGAGG - Intergenic
994353981 5:98774429-98774451 AGCGGTCCGAGCCGAAGGCGGGG - Intronic
995048127 5:107672302-107672324 AGCAGCCTCAGCAGAGCGCGAGG + Intergenic
997364734 5:133318727-133318749 AGCAGGGCCACCTGAAGGTGAGG + Intronic
997438047 5:133889290-133889312 GGCAGCCCCAGCTGACAGCAAGG + Intergenic
1001549043 5:172588662-172588684 AGGAGCACCAGCTGGAGGTGGGG + Intergenic
1002103710 5:176869652-176869674 TGCAGCGCCAGCTGTGGGCGCGG + Intronic
1002259420 5:177983518-177983540 AGCAGCCCAAGGTGGAGGAGGGG - Intergenic
1004364290 6:14998975-14998997 GGCAGCCCCAGCTGACACCGTGG - Intergenic
1005883038 6:30074779-30074801 AGCCGACCCAGCTGAGGGTGAGG - Intronic
1007752406 6:44078345-44078367 AGCTGCCCCACCTGAAGTCTAGG - Intergenic
1008805100 6:55417346-55417368 AGAAGCCACAGCTGAGGGAGGGG - Intergenic
1010070282 6:71736454-71736476 AGAAGCCACAACTGAAGGAGAGG + Intergenic
1011193936 6:84763640-84763662 AACAGCCGCGGCCGAAGGCGCGG + Intronic
1011965859 6:93156756-93156778 AGCAGGCCCAGCCCAAGGAGAGG - Intergenic
1013220642 6:108074584-108074606 AGCAGCCCCAGCGGCAGCCACGG + Exonic
1013279123 6:108618388-108618410 AGCAGCAGCAGATGAAGGAGAGG + Intronic
1014138641 6:117916592-117916614 AGGTGCCCCAGCTGAAGACCAGG - Intronic
1016501558 6:144726272-144726294 AGCAGCTGAAGCTGAAGGTGTGG - Intronic
1017824543 6:158071727-158071749 GGCAGTCCCAGGTGAAGGAGCGG + Exonic
1018385260 6:163297516-163297538 GGAAGCCCAAGCTGAAGGCTGGG - Intronic
1018834211 6:167471061-167471083 GGCAGGCCCAGCTGAAGGGCAGG - Intergenic
1019451271 7:1099877-1099899 AGCAGACGCACCTGACGGCGGGG + Intronic
1019496096 7:1341315-1341337 ATCAGCCCCAGCTGCAGTGGGGG + Intergenic
1019563039 7:1667347-1667369 TGCGGCCCCATCTGAGGGCGGGG + Intergenic
1019595655 7:1857220-1857242 AGCAGCCCCACCAGGAGGCACGG + Intronic
1021971413 7:25968949-25968971 AGCAGCCCCTGCTGATGGCGGGG - Intergenic
1022100602 7:27166867-27166889 GGCAGCCACAGCTCAAGGCCAGG + Intronic
1022963788 7:35454756-35454778 AGCAGCTCCACCTGGAAGCGGGG - Intergenic
1023119917 7:36898967-36898989 ACCAGCCCCAGCTAAAGCCCTGG - Intronic
1026845058 7:73694073-73694095 GGCAGCCCCCGCTGCAGCCGGGG - Intronic
1029736915 7:102470106-102470128 TGAAGCCCCAGGTGAAGGGGAGG - Intronic
1029991546 7:104967149-104967171 AGCAGCACCAGCTGATGGGAAGG + Intergenic
1032003898 7:128284961-128284983 TCCAGCCCCAGCTGACAGCGGGG - Intergenic
1032560962 7:132892721-132892743 AGCAGCTCCAGCTCTAGCCGTGG + Intronic
1035159891 7:156942942-156942964 ACAGGCCCCAGCTGAAGGTGCGG + Intergenic
1035255901 7:157627169-157627191 AGGAGACCCAGCTGCAGGTGCGG - Intronic
1035777397 8:2198778-2198800 AACAGTCCCCTCTGAAGGCGCGG - Intergenic
1037566766 8:20124613-20124635 AGCTTCCCCAGCTGAGGTCGTGG - Intergenic
1037589998 8:20304099-20304121 AGCAGCCCCAGCTGTCAGCCCGG - Intergenic
1038180473 8:25222685-25222707 AGGAGCCCCTGATGGAGGCGAGG - Intronic
1040423230 8:47260197-47260219 AGCCGGCCCAGCAGAAGCCGGGG - Intergenic
1041713274 8:60911824-60911846 AGCAGCCCCTGCAGATGGCTGGG + Intergenic
1045266363 8:100621905-100621927 AGCAGCCCCAGCTGAAGGCGAGG - Intronic
1047364586 8:124200426-124200448 CACAGCCCCATCTGAAGTCGGGG - Intergenic
1048384329 8:133897672-133897694 AGCAGCCCCATTTGCAGGTGAGG + Intergenic
1048804596 8:138228385-138228407 ATCACCCCCAGCTGCAGGAGCGG + Intronic
1049477938 8:142805545-142805567 AGCAGCCCCAGCTTGAGGAGGGG - Intergenic
1049558656 8:143296572-143296594 AGGAGCTGCGGCTGAAGGCGCGG - Exonic
1051563599 9:18470912-18470934 AGCAGCACTAGCAGAAGCCGTGG - Intergenic
1053144871 9:35705563-35705585 AGCAGCCACCGCTGCAGGCTTGG + Exonic
1055612016 9:78032391-78032413 CGCGGCCCCTGCTGAAGTCGCGG + Intergenic
1056906049 9:90648755-90648777 AGCAGCCCCAGTAGGAGGAGGGG - Intergenic
1057236575 9:93366225-93366247 AGCCTCCCCAACTGAAGGCCGGG - Intergenic
1057503808 9:95616504-95616526 AACAGGCCCATCTGAAGGCAAGG + Intergenic
1060018226 9:120106008-120106030 AGCAGCATCAGCTGAGAGCGTGG + Intergenic
1060549437 9:124478031-124478053 AGCGGCCCGAGCTGGAAGCGCGG + Intronic
1060738486 9:126081899-126081921 AGCAGCTCCAGCTAAAGAGGCGG + Intergenic
1061518328 9:131102635-131102657 AGCTGCCCCATCTGTTGGCGAGG + Intronic
1061767275 9:132889312-132889334 ACCAGCCCCAACTGTAGGCAAGG + Intronic
1062578292 9:137218549-137218571 AGCAGTCCCAGCAGCAGGAGCGG - Intergenic
1062702503 9:137914695-137914717 AGCAGCCCAATCTGCAGGAGTGG - Exonic
1186493324 X:9992411-9992433 AGCAGGCCGAGCTGAAGGGGAGG - Intergenic
1189310902 X:40016802-40016824 AGCTGCCCCAGCTGACAGCATGG - Intergenic
1189961966 X:46332705-46332727 ACGTGCCCCAGCTGAAGGCAGGG - Intergenic
1190984000 X:55484317-55484339 AGGAGCAGCAGCTGAAGGTGAGG - Intergenic
1192358576 X:70424792-70424814 AGCAGCCCCAGCTGCAAGCCTGG - Intronic
1193431300 X:81409632-81409654 AGCAGCAGCAGCTTAAGTCGTGG - Intergenic
1193655001 X:84188019-84188041 GGCAGCGCTCGCTGAAGGCGGGG - Intergenic
1195813295 X:108858069-108858091 AGCAGGCCCAGCTGATGAAGGGG + Intergenic
1195957426 X:110346844-110346866 AACAGCTCCAGCTGGAGGCCGGG - Exonic
1197048986 X:122035607-122035629 AGCAGCCCCAGCTACATGGGAGG - Intergenic
1197595118 X:128455031-128455053 AGCTGCCCCAGCTGCAAGTGTGG - Intergenic
1198019233 X:132642186-132642208 AGCAGGCCCAGGTGAATGCGTGG - Intronic
1198502108 X:137260449-137260471 TGCAGCCCCAGCTGAAAGCTTGG - Intergenic