ID: 1045266364

View in Genome Browser
Species Human (GRCh38)
Location 8:100621910-100621932
Sequence AGATTAGCAGCCCCAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045266364_1045266367 -7 Left 1045266364 8:100621910-100621932 CCTTCAGCTGGGGCTGCTAATCT 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1045266367 8:100621926-100621948 CTAATCTTGAAGCAAATGGAGGG No data
1045266364_1045266366 -8 Left 1045266364 8:100621910-100621932 CCTTCAGCTGGGGCTGCTAATCT 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045266364 Original CRISPR AGATTAGCAGCCCCAGCTGA AGG (reversed) Intronic
902138201 1:14329233-14329255 AGATTAGCGGCTCCAGCAGAAGG + Intergenic
902587107 1:17446534-17446556 GGAAGAGCAGGCCCAGCTGATGG - Intergenic
902728466 1:18352741-18352763 AAATTAACAGCCCCAACTGGAGG - Intronic
903306942 1:22419468-22419490 GGAATAGCAGCCGCATCTGAAGG + Intergenic
903888652 1:26555624-26555646 CGGTAAGCAGCCCCAGCTCAGGG + Exonic
905796113 1:40817618-40817640 AGAGGGGCAGCCACAGCTGAGGG - Intronic
907110956 1:51925950-51925972 AGAGGAGCAGCCCCTGCTGGGGG + Intronic
908796583 1:67835907-67835929 AGAGTACCAGCTCCAGCTGCAGG + Intergenic
910959776 1:92749321-92749343 AAATTAGGAGCTCCAGCTGAAGG - Intronic
915478492 1:156168983-156169005 AGGATAGCAGGCCCAGTTGATGG - Intronic
916184491 1:162117566-162117588 AGGTCAGCAGTCCCAGCTGAGGG - Intronic
916533418 1:165680242-165680264 AAATTAACAGCCCCAGCCTAAGG - Intronic
916635398 1:166662576-166662598 ACATTAGCAACCCAACCTGAGGG + Intergenic
917648156 1:177048799-177048821 AGAGGAGCAGAGCCAGCTGAAGG + Intronic
918240437 1:182615721-182615743 AGATTAACAGCCCCTACTTAAGG - Intergenic
920742099 1:208590675-208590697 AAAATTGCAGCTCCAGCTGATGG - Intergenic
922857847 1:228790368-228790390 AGCTGAGCAGCTCCAGCTGGGGG + Intergenic
922857986 1:228791371-228791393 AGATTAGGAGCTCCAGAGGAAGG - Intergenic
1066311937 10:34205876-34205898 AGATGCGCAGCCCCAGGGGATGG - Intronic
1068828098 10:61462358-61462380 AGAGTAGCAGCACAAGGTGAGGG + Intergenic
1069633238 10:69910296-69910318 AGCTTGGCATCCCCAGCTGCTGG - Intronic
1070696476 10:78567541-78567563 AGACAAGCAGCCTCAGATGAGGG + Intergenic
1071281884 10:84110940-84110962 AGATTAGTGTCCCCAACTGAAGG + Intergenic
1073639918 10:105241361-105241383 AGCGCAGCAGCCCCAGGTGAGGG + Intronic
1074558669 10:114515492-114515514 AGATAAGCAGACAGAGCTGACGG + Intronic
1075171561 10:120120594-120120616 AGACCTGCAGCCCCACCTGAAGG - Intergenic
1075589988 10:123684277-123684299 AGATTAGCAGCCCCAGGAACAGG - Intronic
1077753657 11:5002499-5002521 AGACTTGTAGCCCCAGCTGCTGG + Intergenic
1078134736 11:8642374-8642396 AGATTAACAGCCTCAAATGAAGG + Intronic
1079868666 11:25767432-25767454 AAAATAGAAGCCCCAGCTTAAGG - Intergenic
1083243624 11:61408646-61408668 AGCTTAGCAATCCCAACTGAAGG - Intronic
1085250826 11:75142712-75142734 AGACTAGAGTCCCCAGCTGAAGG + Intronic
1086900067 11:92357253-92357275 TAATTATCAGCCCCAGCTCATGG - Intronic
1088007858 11:104963866-104963888 AAATAAGCAGGCACAGCTGAAGG - Intronic
1088017215 11:105075309-105075331 AAATAAGCAGCCACAGCTGAAGG - Intronic
1089813677 11:121153040-121153062 GGAGTAGCAGCCGCAGCTGTGGG - Exonic
1095230811 12:39736878-39736900 AGATGTGCAGCCCCAGCCCATGG + Intronic
1096525430 12:52207403-52207425 TGGCTAGCAGCCCCAGGTGAAGG - Intergenic
1097192719 12:57227082-57227104 AAATTAGCAGCCTCGGCTGCAGG - Intergenic
1097688383 12:62712016-62712038 AGATTTGCAGCTCTAGCTGCAGG - Intronic
1101029596 12:100646117-100646139 AGATAAGTGTCCCCAGCTGAAGG - Intergenic
1105926193 13:25011083-25011105 AAAATAGCAACTCCAGCTGATGG + Intergenic
1106038792 13:26069896-26069918 AAAATAGCAACTCCAGCTGATGG - Intergenic
1110085532 13:71374440-71374462 AGATAAGTAGCCAGAGCTGAGGG + Intergenic
1113864575 13:113512623-113512645 AGATTTGGAGCCCCAGGTGCTGG + Intronic
1113864589 13:113512691-113512713 AGATTTGGAGCCCCAGGTGCTGG + Intronic
1113864603 13:113512759-113512781 AGATTTGGAGCCCCAGGTGCTGG + Intronic
1114621470 14:24098803-24098825 AGAGCAGCAGTCCCAGCAGAGGG + Intronic
1115148360 14:30253682-30253704 AGATTAGGACTCCCTGCTGATGG - Intergenic
1117422475 14:55560421-55560443 AGATTAGTAACCCTAGCTAAAGG - Intronic
1123964994 15:25446284-25446306 AGATTAGCAGCAGCAGCAGCTGG - Intergenic
1125540095 15:40465238-40465260 AGGTCAGCAGGCCCAGCAGAGGG + Intronic
1132898950 16:2243151-2243173 GGAAGAGCAGCCCCAGCTGCAGG + Exonic
1133860617 16:9591507-9591529 AGATTAGCAGCCTAGGCTCATGG + Intergenic
1134858692 16:17541666-17541688 ACAGTAGCAGCCACAGCTAAAGG - Intergenic
1141786314 16:86203199-86203221 GGATTAGCAGCGCCTGCTGTGGG + Intergenic
1141984648 16:87571923-87571945 AGCAGAGCAGCCCCAGCAGAGGG + Intergenic
1142399173 16:89850381-89850403 CGATGAGCCGCTCCAGCTGAGGG - Exonic
1142717354 17:1754515-1754537 AGTTTGGCAGCCCCAAGTGAGGG + Exonic
1143973557 17:10813430-10813452 AGATCAGCAGCCAGAGGTGAAGG + Intergenic
1144023749 17:11259770-11259792 AAATTAGCTGACCCAGCTGGAGG + Intronic
1145221958 17:21096835-21096857 TGGTCAACAGCCCCAGCTGAGGG - Intergenic
1149042611 17:52207988-52208010 AGCTCTGCAGCCCCAGCAGATGG + Intergenic
1150773634 17:68061976-68061998 TCATTGGCAGCCACAGCTGATGG + Intergenic
1153654174 18:7267497-7267519 AGTTTAGAAGTACCAGCTGAAGG - Intergenic
1155350077 18:24897571-24897593 AGCTCAGCAGACCCAGCTGAAGG + Intergenic
1160733755 19:652575-652597 AGATTAGCCGCCGAGGCTGAGGG + Intronic
1163365363 19:16873106-16873128 AGATTTGAACTCCCAGCTGATGG - Intronic
1165716908 19:38052353-38052375 AGATGAGCAACCAGAGCTGAAGG + Intronic
1165826902 19:38710696-38710718 ACATTGACAGCACCAGCTGAAGG - Intronic
1167311814 19:48741338-48741360 AGATCAGCAGCCCCAGAAGGCGG + Exonic
925151867 2:1620393-1620415 AGGCTGGCAGCTCCAGCTGATGG - Intergenic
926758688 2:16257168-16257190 GGATTGGCAGGCACAGCTGAAGG + Intergenic
927763708 2:25784310-25784332 AGACTTGCAGCCAAAGCTGAAGG - Intronic
927844036 2:26462203-26462225 TGGTTAGCAGCCCCAGGTGGGGG + Intronic
933831273 2:86211294-86211316 AGACTAGCAGCAGGAGCTGAAGG - Exonic
935851127 2:107220221-107220243 AGATCAGAAGCCCCAAATGACGG + Intergenic
937910906 2:127075223-127075245 AGAATATCAGCCCCATCTCAAGG + Intronic
944530796 2:200665796-200665818 AGATAAGTGGCCTCAGCTGAAGG - Intronic
946216387 2:218187034-218187056 AGACTAGAAGCCCCAGATCAGGG + Intergenic
1172938059 20:38634784-38634806 AGGTGAGCAGCCCCAGCCCAGGG + Exonic
1173676031 20:44836383-44836405 ACAGTAACAGCACCAGCTGAAGG - Intergenic
1174566953 20:51471868-51471890 AGATTTCCAGCGCCAGCTGATGG + Intronic
1179714992 21:43281941-43281963 AGCTTATCAGCCCCCGCTGCAGG - Intergenic
1180786618 22:18551228-18551250 TGATTAGCAGCCCCAACTAATGG - Intergenic
1181131910 22:20737041-20737063 TGATTAGCAGCCCCAACTAATGG - Intronic
1181243533 22:21490749-21490771 TGATTAGCAGCCCCAACTAATGG - Intergenic
1181521832 22:23452703-23452725 AGATGAGAAGCCGCAGCTGCTGG - Intergenic
1183096334 22:35554375-35554397 AGAGTAGCAGCCCCAGCCCCAGG - Intergenic
1184019171 22:41809070-41809092 GGATAAGCAGGCCCAGCTGGCGG + Intronic
949146099 3:701543-701565 AGTGTAGAAGCCACAGCTGATGG - Intergenic
950726591 3:14921064-14921086 AGATGGGCAGCCCCACCTGAAGG - Intronic
953788861 3:45931140-45931162 AGAGGAGAAGACCCAGCTGATGG + Exonic
954652686 3:52175016-52175038 GGATGAGCAGCCCAAGCAGAGGG - Intergenic
954824885 3:53364048-53364070 ACATTAGCATCCCCAACTGCTGG - Intergenic
955346846 3:58167860-58167882 AGAACAGCAGCTCCCGCTGACGG - Intronic
955800300 3:62679504-62679526 AGAGTAGCAGCTCCCACTGATGG + Intronic
956963454 3:74430930-74430952 AGAGTAGCACACACAGCTGATGG - Intronic
957840199 3:85658377-85658399 AGATTAGAAGTCCTAGATGAAGG - Intronic
960398614 3:117168469-117168491 TGGTTAGTAGCCCCAACTGATGG - Intergenic
967525312 3:190486200-190486222 AAATGAGGAACCCCAGCTGAGGG - Intergenic
971427238 4:26528507-26528529 AGAGTTGCAGCCACACCTGAAGG - Intergenic
971780610 4:31029476-31029498 ATATTTGCAGGCACAGCTGAAGG + Intronic
973078295 4:45958693-45958715 GGATTAGGAGCCCCAGCTTGAGG - Intergenic
973642274 4:52915247-52915269 AGGTCAGCAGCCCCAGCTGATGG - Intronic
975539596 4:75493217-75493239 AGATTTTCAGCCCCAGCTTAAGG - Intronic
980779798 4:137480791-137480813 AGATAAGTGTCCCCAGCTGAAGG + Intergenic
984710592 4:182880972-182880994 GGGTTTGCAGCCCCAGCTGCGGG - Intergenic
985020203 4:185680858-185680880 AGATGAGGAGCCCCAGGAGACGG + Intronic
985698872 5:1358667-1358689 AGACTCCCAGCCCCACCTGAGGG + Intergenic
986083984 5:4424464-4424486 AGGTTGACAGCCCCAGCCGAGGG - Intergenic
988278596 5:29114650-29114672 AGCATAGAAGCCACAGCTGAAGG - Intergenic
988874322 5:35427283-35427305 AGATCAGCAGCCCCAGTAAAAGG - Intergenic
989608895 5:43272875-43272897 AGAGTAGCTGCCCCAGTGGAAGG - Intronic
990796169 5:59543606-59543628 AGATTAACAGACCCAGCTGCTGG + Intronic
991444090 5:66681341-66681363 AGATTTGCTTCCCCAGCTGCTGG + Intronic
992204882 5:74421541-74421563 AGATGAGAACCACCAGCTGAAGG - Intergenic
992735328 5:79713589-79713611 TGAATAACAGCCCCAGCTCATGG + Intronic
995946225 5:117649955-117649977 GGAGTTGCAGCCCCATCTGAAGG + Intergenic
998175851 5:139901653-139901675 AGATTAGCATCACTAGCTGAGGG - Intronic
999071383 5:148747365-148747387 AGACTACCACCCCCAGTTGAAGG + Intergenic
1000475107 5:161697257-161697279 AGCATAGCAGCTTCAGCTGATGG - Intronic
1001290118 5:170451037-170451059 AGGCAAGCAGCCCCAACTGACGG + Intronic
1001425065 5:171617559-171617581 AGAGTGGCAGCCCCAGATGGAGG - Intergenic
1005738041 6:28767283-28767305 AGATCAGCAGCCCTAGTTCAAGG - Intergenic
1011947922 6:92930442-92930464 CGATTACCAGTCCCAGCGGAAGG + Intergenic
1014547090 6:122746744-122746766 AGATAAGTGTCCCCAGCTGAAGG - Intergenic
1016684186 6:146863017-146863039 AGTTCAATAGCCCCAGCTGAAGG + Intergenic
1018014650 6:159701174-159701196 AGATGAGCAGCAGCAGCAGAAGG + Intronic
1019589507 7:1823783-1823805 AGATGAGAAGCCGCAGCTGCTGG + Intronic
1023031188 7:36091838-36091860 GGATTTGGAGCCCCAGCAGAGGG - Intergenic
1026328126 7:69328670-69328692 AGATTAGTAGCCACACCTAAGGG + Intergenic
1026889986 7:73976179-73976201 AGATCAGCAACCATAGCTGAAGG - Intergenic
1031844379 7:126786817-126786839 AGATTGGCACATCCAGCTGATGG - Intronic
1033659223 7:143392221-143392243 AGAATAACAGCCGAAGCTGAAGG - Intronic
1036077420 8:5516921-5516943 AGCTCAGCAGCCCCAGGGGAAGG - Intergenic
1041903469 8:63007560-63007582 TGATTACCAGCAACAGCTGATGG - Intergenic
1043922923 8:86004436-86004458 AGATTCCCAGCCTCAGCTGCAGG + Intronic
1044901132 8:96945953-96945975 AAATGAGCAGCCACTGCTGAAGG - Intronic
1045266364 8:100621910-100621932 AGATTAGCAGCCCCAGCTGAAGG - Intronic
1048995907 8:139793621-139793643 AGCTCAGGAGCCTCAGCTGAAGG + Intronic
1050453460 9:5808459-5808481 ATGTTAGCAGCTCCTGCTGAAGG - Intronic
1050627963 9:7526081-7526103 AGTTGAGCAATCCCAGCTGATGG - Intergenic
1056715351 9:89024045-89024067 AGAACAGCAGCTCCAGCTGTGGG + Intronic
1059159677 9:112022148-112022170 AGGAGAGCAGGCCCAGCTGAGGG - Intergenic
1062023040 9:134328027-134328049 GGATTAGCACCCCCAGCTCGTGG + Intronic
1062443498 9:136583828-136583850 AGAGGGGCAGCCCCGGCTGAGGG + Intergenic
1203561141 Un_KI270744v1:59786-59808 AGAGCTGCAGCCCCAGCTGCCGG - Intergenic
1188159350 X:26781867-26781889 AAATAAGCAGGCACAGCTGAAGG + Intergenic
1189289381 X:39874501-39874523 TGACCAACAGCCCCAGCTGAGGG + Intergenic
1192451670 X:71248698-71248720 AGTTCTGCAGCCCCAGCTGCTGG - Exonic
1197138665 X:123092162-123092184 GGAAAGGCAGCCCCAGCTGAAGG + Intergenic
1198567932 X:137924303-137924325 AGTGTTGCAGGCCCAGCTGAAGG + Intergenic
1199686248 X:150268175-150268197 ATATTTGCATCCCCAGTTGAGGG + Intergenic
1199827330 X:151513656-151513678 AGGTTAGCAGCATCAGCAGATGG - Intergenic
1201148981 Y:11084729-11084751 GGATTAGCAGCCCCTATTGAAGG + Intergenic