ID: 1045266366

View in Genome Browser
Species Human (GRCh38)
Location 8:100621925-100621947
Sequence GCTAATCTTGAAGCAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045266355_1045266366 26 Left 1045266355 8:100621876-100621898 CCCTCGGAAGAAGGAAGGAAGGG 0: 1
1: 1
2: 1
3: 40
4: 365
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data
1045266363_1045266366 -3 Left 1045266363 8:100621905-100621927 CCTCGCCTTCAGCTGGGGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 265
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data
1045266357_1045266366 25 Left 1045266357 8:100621877-100621899 CCTCGGAAGAAGGAAGGAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data
1045266364_1045266366 -8 Left 1045266364 8:100621910-100621932 CCTTCAGCTGGGGCTGCTAATCT 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1045266366 8:100621925-100621947 GCTAATCTTGAAGCAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045266366 Original CRISPR GCTAATCTTGAAGCAAATGG AGG Intronic
No off target data available for this crispr