ID: 1045271455

View in Genome Browser
Species Human (GRCh38)
Location 8:100665290-100665312
Sequence GGGAAATGTACTTAGTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045271448_1045271455 12 Left 1045271448 8:100665255-100665277 CCACCGTGCCTGGCTGAGACATC No data
Right 1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG No data
1045271450_1045271455 4 Left 1045271450 8:100665263-100665285 CCTGGCTGAGACATCCTGAATAA No data
Right 1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG No data
1045271454_1045271455 -10 Left 1045271454 8:100665277-100665299 CCTGAATAAAAAGGGGAAATGTA No data
Right 1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG No data
1045271449_1045271455 9 Left 1045271449 8:100665258-100665280 CCGTGCCTGGCTGAGACATCCTG No data
Right 1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045271455 Original CRISPR GGGAAATGTACTTAGTGTAC AGG Intergenic
No off target data available for this crispr