ID: 1045272011

View in Genome Browser
Species Human (GRCh38)
Location 8:100670219-100670241
Sequence TGCTATACCCCCAGTGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045272005_1045272011 24 Left 1045272005 8:100670172-100670194 CCCTCTAGAATACAATCTCCAAC No data
Right 1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG No data
1045272003_1045272011 28 Left 1045272003 8:100670168-100670190 CCTCCCCTCTAGAATACAATCTC No data
Right 1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG No data
1045272006_1045272011 23 Left 1045272006 8:100670173-100670195 CCTCTAGAATACAATCTCCAACA No data
Right 1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG No data
1045272004_1045272011 25 Left 1045272004 8:100670171-100670193 CCCCTCTAGAATACAATCTCCAA No data
Right 1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG No data
1045272008_1045272011 6 Left 1045272008 8:100670190-100670212 CCAACAGGACAGAGATTTGTCTA No data
Right 1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045272011 Original CRISPR TGCTATACCCCCAGTGCCTT GGG Intergenic
No off target data available for this crispr