ID: 1045272260

View in Genome Browser
Species Human (GRCh38)
Location 8:100671926-100671948
Sequence CCAATCAGATAGTTTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045272260_1045272266 25 Left 1045272260 8:100671926-100671948 CCTGGCCAAAACTATCTGATTGG No data
Right 1045272266 8:100671974-100671996 AAGGTACCCTCTAGTTTGCCTGG No data
1045272260_1045272263 6 Left 1045272260 8:100671926-100671948 CCTGGCCAAAACTATCTGATTGG No data
Right 1045272263 8:100671955-100671977 ATCTTAGCCCAGTCAATAGAAGG No data
1045272260_1045272267 26 Left 1045272260 8:100671926-100671948 CCTGGCCAAAACTATCTGATTGG No data
Right 1045272267 8:100671975-100671997 AGGTACCCTCTAGTTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045272260 Original CRISPR CCAATCAGATAGTTTTGGCC AGG (reversed) Intergenic
No off target data available for this crispr