ID: 1045277439

View in Genome Browser
Species Human (GRCh38)
Location 8:100721201-100721223
Sequence CCGGCAGCGCGGGTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045277429_1045277439 22 Left 1045277429 8:100721156-100721178 CCGAGAAAATGGTCGCAAAGGAG 0: 1
1: 0
2: 4
3: 8
4: 107
Right 1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 156
1045277435_1045277439 -8 Left 1045277435 8:100721186-100721208 CCGGGCGTGTGGCTGCCGGCAGC 0: 1
1: 0
2: 3
3: 13
4: 164
Right 1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045277439 Original CRISPR CCGGCAGCGCGGGTCCCCGC CGG Intronic
900091745 1:923855-923877 CGGGCGGCGCGGGCTCCCGCGGG - Intergenic
900703381 1:4061566-4061588 CCCGCACCGCGGGACCCAGCCGG + Intergenic
905734354 1:40315633-40315655 CCGGGAGAGCGGGGCCCCCCGGG - Exonic
905996022 1:42381012-42381034 CCGGCAGCGCTGCTCCGAGCAGG + Exonic
907051191 1:51330668-51330690 GCGGGAGCGCGGGTCGCCGCGGG - Intronic
910251321 1:85201343-85201365 CCCGGGGCGCGGGTCCCCGGAGG - Intergenic
910876784 1:91885801-91885823 CAGGCTGCGCGGGTGCCCGTCGG - Intronic
918048289 1:180954212-180954234 CCGCCCGCGCGAGGCCCCGCGGG - Intergenic
922730604 1:227947180-227947202 CCGGGAGCGCAGGGCCCGGCCGG - Intronic
923171666 1:231422311-231422333 CCGCCCGCCCGGGTCGCCGCGGG - Exonic
1063511355 10:6647843-6647865 GCCGCAGCGCGGGGCCCGGCGGG + Intergenic
1063929955 10:11018453-11018475 GCGGCGTCCCGGGTCCCCGCGGG + Intronic
1064230768 10:13528399-13528421 CCGCCCGCGGGGGTCCACGCTGG - Intronic
1064552890 10:16520838-16520860 CCGGGAAGGCGGGTCCGCGCGGG - Exonic
1070741803 10:78908084-78908106 CCGGCAGCCGTGGGCCCCGCAGG + Intergenic
1075106483 10:119542968-119542990 CCGGCGGCGCGGGCTCCCTCTGG - Intergenic
1075871350 10:125774230-125774252 CCGGCAGCGCGTTCGCCCGCTGG + Exonic
1076523025 10:131093031-131093053 CCCGCAGTGCCGGTGCCCGCTGG + Exonic
1077097487 11:805168-805190 CCTGCAGCGCAGGTACGCGCCGG - Exonic
1077253822 11:1571981-1572003 CCGGCTGCGCGGGCCCCCGCCGG - Intergenic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1078514328 11:12009302-12009324 GCGGCAGCGCCGGTACCCGAGGG + Intronic
1083572639 11:63768593-63768615 CCGGCTCCGGTGGTCCCCGCCGG + Exonic
1083740958 11:64711585-64711607 CGGGCAGCGCGGGTGCTGGCCGG + Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084000145 11:66291762-66291784 CCGGCAGCGCCTGGCACCGCGGG - Intergenic
1084979718 11:72822599-72822621 TCGGCAGCCTGGGTCGCCGCAGG - Intronic
1088975520 11:114812991-114813013 CCGGCAGCGAGGTGCCCTGCTGG + Intergenic
1090904672 11:131064815-131064837 CTGGCAGCGCTGGTCCCTCCAGG + Intergenic
1091233491 11:134003214-134003236 CACGCAGCCCGGGTTCCCGCTGG + Intergenic
1096775570 12:53961501-53961523 CCGGCAGCTCTGGTCTCCTCCGG + Intergenic
1101371760 12:104137690-104137712 GCGGCGGCGCGAGTCCCCGGGGG - Intronic
1102933840 12:116881236-116881258 CCTGCAGCGCGGGTCGCCTGGGG - Exonic
1105327336 13:19382400-19382422 CCCGCAGCGCGGGGCCCGGAGGG + Intergenic
1105833243 13:24184374-24184396 CCTGCTGTGCGGGTCCCAGCTGG + Intronic
1107359445 13:39603087-39603109 CCGGGAGTGGGGGTCTCCGCTGG - Exonic
1110450881 13:75636395-75636417 CTGACTGCCCGGGTCCCCGCGGG + Intronic
1111657906 13:91175351-91175373 CCGGCATTGGTGGTCCCCGCTGG + Intergenic
1111951438 13:94712127-94712149 CCGGCCGAGCGGGTCTCCGCGGG - Exonic
1112503020 13:99956749-99956771 CCCGCGGCCCGGGTCCCAGCGGG - Intergenic
1113116794 13:106882729-106882751 CCAGCAGCGCGGCTTCCCACAGG - Intergenic
1113831197 13:113297152-113297174 CCGGCGGCTCGGCTCCCCGCAGG - Intergenic
1113909510 13:113835586-113835608 CTTGCAGCGCGCCTCCCCGCAGG + Exonic
1117805187 14:59483922-59483944 CGGGCCTCGCGGGTGCCCGCAGG + Exonic
1119643157 14:76329752-76329774 CTGCCAGCCCGGGTCCCAGCAGG + Intronic
1119759643 14:77141483-77141505 CCGGCAGCGCCGGCAGCCGCGGG + Intronic
1121595229 14:95157229-95157251 CCTGCAGCACGGGGCGCCGCGGG + Intronic
1122413811 14:101539095-101539117 CCGGCAGCCCCGGGCCCCTCTGG + Intergenic
1123787467 15:23687414-23687436 GGGGCAGCGCGGGGCCCCGACGG + Intergenic
1130261336 15:82355938-82355960 CCGGCTGCACGGGTCCCAGAGGG - Intergenic
1130279899 15:82513080-82513102 CCGGCTGCACGGGTCCCAGAGGG + Intergenic
1130471274 15:84229266-84229288 CCGGCTGCACGGGTCCCAGAGGG + Intergenic
1130478768 15:84343837-84343859 CCGGCTGCACGGGTCCCAGAGGG + Intergenic
1130493002 15:84444294-84444316 CCGGCTGCACGGGTCCCAGAGGG - Intergenic
1130593569 15:85233893-85233915 CCGGCTGCACGGGTCCCAGAGGG + Intergenic
1131263570 15:90902797-90902819 CCGGCGGCCCGGGGCCCAGCGGG + Intronic
1132900413 16:2251251-2251273 CCGCGAGCGCGGACCCCCGCGGG + Intronic
1133121566 16:3611720-3611742 CCGGAAGCGCTGGCCGCCGCGGG - Intronic
1136724793 16:32348935-32348957 CCAGCCGCGCGCGCCCCCGCGGG + Intergenic
1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG + Intronic
1141608790 16:85170001-85170023 CCGGCTGCGCGGGGCCGCGGAGG + Intergenic
1142092847 16:88224330-88224352 ACAGCACCGCGGGGCCCCGCAGG + Intergenic
1142132485 16:88437366-88437388 CCGGCAGCCCGGGCCCCCCCAGG + Exonic
1142178135 16:88654411-88654433 CCTGCAGCTCGGGACCCCGCAGG - Intronic
1142293048 16:89201454-89201476 CCAGCAGCGCGGGTCCGCGCAGG + Exonic
1203001637 16_KI270728v1_random:168820-168842 CCAGCCGCGCGCGCCCCCGCGGG - Intergenic
1203133240 16_KI270728v1_random:1705226-1705248 CCAGCCGCGCGCGCCCCCGCGGG - Intergenic
1144788941 17:17846963-17846985 CTGGCACCGAGGGTCCCTGCAGG - Exonic
1147148278 17:38498610-38498632 CCGGCAGGGGAGGGCCCCGCTGG - Intronic
1147400604 17:40178145-40178167 CGGGCAGCGGGGGGCCCTGCTGG + Intronic
1148896211 17:50840604-50840626 CCGACAGCGCTGGTTCCCCCTGG - Exonic
1148899693 17:50866481-50866503 CCGGCACCCCGGTCCCCCGCCGG + Intronic
1148909255 17:50931713-50931735 CGGGGAGCGCAGGTCCCGGCAGG + Intergenic
1151559220 17:74861737-74861759 CCGGCGGGGCGGGCCCTCGCGGG - Intergenic
1152552216 17:81035452-81035474 CCAGCAGCCCGGGTCCCGGGTGG - Intronic
1152586385 17:81191335-81191357 CAGGCAGCGCATGTCCCCCCAGG - Exonic
1152921380 17:83068196-83068218 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921394 17:83068230-83068252 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921557 17:83068672-83068694 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921627 17:83068846-83068868 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1154174502 18:12076615-12076637 GCGGCTGCGCGCGGCCCCGCCGG + Intergenic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1157842049 18:50967992-50968014 GCGGCCGCGCGGGACCCGGCCGG + Intronic
1158266401 18:55664899-55664921 CCCGCAGCCCCGGTTCCCGCCGG - Intergenic
1160798227 19:955374-955396 CCAGCAGCTGGGGCCCCCGCAGG + Intronic
1160864309 19:1250310-1250332 CCGGCAGCTCCGGGCGCCGCCGG - Exonic
1160991688 19:1862890-1862912 CCGGCAGGGCGGGGCCTCGGTGG - Intronic
1161048833 19:2151412-2151434 CCGGCAGCGCGGCGCTCCGCGGG - Exonic
1163633697 19:18429120-18429142 CCGGCATGACGAGTCCCCGCGGG - Intronic
1165161695 19:33820413-33820435 TGGGGAGCCCGGGTCCCCGCAGG + Intergenic
1165386714 19:35514260-35514282 CCGACACCGAGGGTCCCCCCGGG - Intergenic
1166307081 19:41941018-41941040 GCTGCAGCGGGGGTTCCCGCGGG - Intergenic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
1168106988 19:54171833-54171855 CGGGCTGTGCGGGTCCCAGCTGG + Intronic
925047010 2:780243-780265 CCAGCAGCAGGGGTCCCGGCAGG - Intergenic
926268184 2:11344680-11344702 CCGCCGGCGCGCGTCCCCGCCGG + Intronic
927256366 2:21043918-21043940 CCAGCAGCGCGGGCCTCGGCGGG + Exonic
928606266 2:32947309-32947331 CCGCCATCGCGGGCCCCAGCGGG - Exonic
929760444 2:44802075-44802097 CGGGCGGCGCGGGCCCTCGCAGG - Intergenic
931670841 2:64645267-64645289 CCGGCCGCGCGGGGGCCCGCAGG + Intronic
932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG + Intergenic
933886138 2:86720494-86720516 CCGGCTGCGCGGGGCTCCCCCGG + Exonic
933924043 2:87076212-87076234 CCGGCTGCGCGGGGCTCCCCCGG - Intergenic
936396932 2:112138470-112138492 CGGGCGGCGCCGATCCCCGCGGG + Exonic
945745743 2:213718500-213718522 CAGGCAGCCCCGGTTCCCGCTGG - Intronic
946230056 2:218285802-218285824 CCGGCAGCCCTGGTCCCCGGAGG - Exonic
946235660 2:218323178-218323200 CCGGCAGGCAGGTTCCCCGCGGG + Intronic
948369043 2:237475642-237475664 CAGGCAGCGCGGACCCCCTCGGG - Intergenic
1169262660 20:4149384-4149406 CCGGCAGCCCGAGTCGTCGCGGG - Intronic
1169832330 20:9838683-9838705 CCAGCGGCGCGCATCCCCGCAGG + Intronic
1173865214 20:46308619-46308641 CCGGCTGCGGGGGTCCGGGCCGG - Intergenic
1175036517 20:56005391-56005413 CGCGCAGCGCGGGTCCGCGGCGG - Exonic
1175293364 20:57892979-57893001 CCGGCATGGCAGGACCCCGCTGG - Intergenic
1175847023 20:62064840-62064862 CCGGCCGCCGGGGGCCCCGCGGG - Exonic
1179577447 21:42316938-42316960 CCTGCAGCTGGGGTCCCCGGTGG + Intergenic
1180612550 22:17107357-17107379 CCGGCACTGGGGGTCCCAGCTGG + Intronic
1180796801 22:18609832-18609854 CCTGCAGCGCGAGTCCCAGCGGG - Exonic
1180875059 22:19171352-19171374 CCTCCAGCGTGGGCCCCCGCTGG + Intergenic
1180999186 22:19980071-19980093 CCGCCAGCGCGGCTCCTTGCGGG + Exonic
1181224923 22:21385439-21385461 CCTGCAGCGCGAGTCCCAGCGGG + Exonic
1181253709 22:21549374-21549396 CCTGCAGCGCGAGTCCCAGCGGG - Exonic
1181512468 22:23395035-23395057 CCGGCAGCGAGGGTCCCTCAGGG + Intergenic
1181698926 22:24609081-24609103 CCGACACCCCGGGTCCCAGCTGG - Intronic
1183540736 22:38427965-38427987 GCGCCAGCGCGTGTCCACGCAGG + Exonic
1183546265 22:38455995-38456017 CGGGCAGGGCGGGGTCCCGCGGG - Intergenic
1183586514 22:38755952-38755974 CGCGCAGCGCGGGCCTCCGCCGG - Exonic
1185133176 22:49052132-49052154 CCAGGAGCGCGTGTCCCCGCCGG + Intergenic
1185142261 22:49109081-49109103 GCGGCAGAGCGGGTCCCCCATGG + Intergenic
1185199290 22:49491857-49491879 CCGGCTGTGCGGGTCCTCGCAGG + Intronic
952354198 3:32570143-32570165 GAGGGAGGGCGGGTCCCCGCAGG + Intronic
952476714 3:33718066-33718088 CCTCCAGTGCGGGTCCCCGCGGG + Intronic
954275635 3:49539983-49540005 CCGGCAGCGCGGGGCCGAGCGGG + Intergenic
954539488 3:51384436-51384458 ACGGCAGCGGGGGACCCCGAGGG + Intergenic
956675025 3:71725300-71725322 GCGGCGGCGCGGGACCCCGGCGG + Exonic
961322320 3:126084260-126084282 CCGGCAGCGCAGAGCCCCGCCGG + Exonic
961657954 3:128453641-128453663 CCGGCTGCTCGGGTGACCGCAGG + Intergenic
965744242 3:171907401-171907423 CAGGCAGCCCCGGTTCCCGCCGG + Intronic
968570815 4:1339620-1339642 GCGGCATCGCGGGTCACTGCAGG - Exonic
971018959 4:22515745-22515767 GCGGCTGCGCGCGGCCCCGCCGG + Exonic
974590631 4:63943225-63943247 CGCGCAGCCCGGGTTCCCGCTGG + Intergenic
982157207 4:152535260-152535282 CCGGCCCCCCGGGTCCCCCCCGG + Exonic
982408190 4:155044313-155044335 CAGGCAGCCCCGGTTCCCGCTGG - Intergenic
985996692 5:3600855-3600877 CAGCCAGCGCGGCTCCCGGCTGG - Intronic
986296822 5:6446333-6446355 CTGGCACAGGGGGTCCCCGCTGG + Intergenic
992939617 5:81750376-81750398 GCGGCCGAGCGGGGCCCCGCGGG - Intronic
992962835 5:81972441-81972463 CCGGGGAAGCGGGTCCCCGCCGG + Intronic
995326431 5:110894300-110894322 CCAGCAGCGCGAGTTCCCGGTGG - Intergenic
995354602 5:111224023-111224045 CCTCCAGCTCCGGTCCCCGCGGG + Intronic
997297682 5:132777789-132777811 CCGGACGCGCGGGTCCCGCCGGG - Intronic
1001575806 5:172763206-172763228 CCTGCAGCGCGGGGCCCCGAGGG - Intergenic
1002925585 6:1604368-1604390 CCGCCCGCGTGGGACCCCGCAGG - Intergenic
1004272904 6:14211176-14211198 CCGGCCGAGCGGGAGCCCGCGGG - Intergenic
1005856096 6:29864192-29864214 CCGGGAGGCTGGGTCCCCGCGGG + Intergenic
1012476451 6:99619113-99619135 CCGGCATCGCGGGTCTTCCCAGG - Intergenic
1014517737 6:122400017-122400039 CCGGCAGCGCCGCTCTCCTCAGG + Intronic
1019127981 6:169853918-169853940 CCGGCAGCGCTGGGCCCCGTCGG + Intergenic
1019457538 7:1138253-1138275 CCTGGGGCGCGGGTCCCTGCCGG - Intronic
1024579934 7:50793284-50793306 CGGCGGGCGCGGGTCCCCGCGGG + Intronic
1027956018 7:84880593-84880615 CGCGCAGCCCGGGTTCCCGCCGG - Intergenic
1029569991 7:101362998-101363020 CCGGGACTCCGGGTCCCCGCGGG + Exonic
1032195269 7:129785019-129785041 GATGCAGCGCGGGTCCCTGCTGG - Intergenic
1034088209 7:148339504-148339526 CCGGCAGCCCGAGTCCCGGCGGG - Intronic
1035354208 7:158267292-158267314 CCGGCAGAGCTGGTTCCCGCGGG + Intronic
1036755160 8:11466681-11466703 CGGGCAGCGCGGACCCGCGCAGG - Exonic
1038484140 8:27921701-27921723 CAGGCGGCGCGTGTCCTCGCTGG + Exonic
1040950984 8:52939212-52939234 TCCGCAGCTCGCGTCCCCGCCGG - Exonic
1043502931 8:80874231-80874253 CCGGCCGCCGGCGTCCCCGCCGG - Intronic
1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG + Intronic
1045674006 8:104588704-104588726 CCGGTAGCCAGGGTCTCCGCGGG + Intronic
1049020314 8:139952510-139952532 CCGGCAGCTCGGGTCACCAGAGG + Intronic
1049671204 8:143870670-143870692 CCGGCAGCGCGAGGTCACGCTGG - Exonic
1049685923 8:143939298-143939320 CAGGCAGGGCGGGCCCCTGCGGG - Intronic
1053312234 9:37027197-37027219 CCGGCAGCGCGGGGTCCTGGCGG + Intronic
1056965300 9:91159988-91160010 CCGGCAGGGCGGGTGCGGGCCGG - Intergenic
1057489284 9:95508907-95508929 CCGGCAGCGCTGAGACCCGCCGG - Intronic
1060106523 9:120876579-120876601 CCGGGAGCGCGGGGCCGGGCGGG + Intronic
1062561966 9:137145668-137145690 GTGGGAGGGCGGGTCCCCGCGGG + Intronic
1190758604 X:53422149-53422171 TCCGCCGCGCGGCTCCCCGCCGG - Intronic
1200052817 X:153443924-153443946 CCTGCAGCCCGTGTCCCCGTAGG - Intergenic
1200084829 X:153599021-153599043 CCTGCAGCGCGGGGCCCGGAGGG - Exonic
1200128915 X:153830658-153830680 GCGGCAGCGGCGGGCCCCGCGGG - Intergenic