ID: 1045277739

View in Genome Browser
Species Human (GRCh38)
Location 8:100722349-100722371
Sequence CCACGGACGCGACGCAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045277739_1045277751 -1 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277751 8:100722371-100722393 GGGGTGGGGAGGACGGCTCGCGG 0: 1
1: 0
2: 4
3: 54
4: 559
1045277739_1045277753 3 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277753 8:100722375-100722397 TGGGGAGGACGGCTCGCGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 160
1045277739_1045277754 10 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277754 8:100722382-100722404 GACGGCTCGCGGGCGGTCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 36
1045277739_1045277752 0 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277752 8:100722372-100722394 GGGTGGGGAGGACGGCTCGCGGG 0: 1
1: 0
2: 4
3: 30
4: 267
1045277739_1045277755 11 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277755 8:100722383-100722405 ACGGCTCGCGGGCGGTCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1045277739_1045277757 13 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277757 8:100722385-100722407 GGCTCGCGGGCGGTCCTCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1045277739_1045277759 25 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277759 8:100722397-100722419 GTCCTCGGGGGTGTTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1045277739_1045277749 -8 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277749 8:100722364-100722386 GTCCGTGGGGGTGGGGAGGACGG 0: 1
1: 0
2: 13
3: 110
4: 1150
1045277739_1045277756 12 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277756 8:100722384-100722406 CGGCTCGCGGGCGGTCCTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 67
1045277739_1045277758 19 Left 1045277739 8:100722349-100722371 CCCGCGCTGCGTCGCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1045277758 8:100722391-100722413 CGGGCGGTCCTCGGGGGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045277739 Original CRISPR CCACGGACGCGACGCAGCGC GGG (reversed) Exonic
900165866 1:1244089-1244111 CCACAGAGGCCACGGAGCGCCGG - Exonic
901019638 1:6249299-6249321 CCACGGACGCCAGGCAGGCCAGG - Exonic
919811465 1:201411460-201411482 ACACGGACTCGACGCAGGGGCGG + Exonic
1076517646 10:131057165-131057187 CCACGGATACTACGCAGTGCTGG - Intergenic
1077238612 11:1498436-1498458 CCACGGCTGCGACGCTGCGATGG - Intronic
1091923100 12:4321245-4321267 CCACCGACGGGACGCGGCTCCGG + Exonic
1095440781 12:42237737-42237759 ACCCGGACACGACGCGGCGCGGG + Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104901052 12:132189734-132189756 GCACGGAGGAGACGCAGCGACGG + Intergenic
1117315092 14:54565947-54565969 CCCCGGACCCGGCGCAGGGCGGG - Intergenic
1118725876 14:68628671-68628693 CCACGCCCGCGACTCAGCCCAGG - Intronic
1126634182 15:50765603-50765625 CCACGGAGGCAGCGCAGCGGCGG - Exonic
1128743886 15:70100503-70100525 CCAGGGACGCGGCGCCTCGCCGG + Intergenic
1133197849 16:4183805-4183827 CCAGGGACGCGAGCCAGCGCTGG + Intergenic
1142894090 17:2963499-2963521 CCAGGGACGGGACCCAGAGCAGG - Intronic
1151875974 17:76868545-76868567 CCATGGGCGCGGCGCGGCGCGGG + Intronic
1153952241 18:10067375-10067397 CCACGGACATGAGGCAGAGCAGG + Intergenic
1165402835 19:35612871-35612893 CCCCGGAATCGACGCTGCGCAGG + Exonic
1167796093 19:51709776-51709798 CCAGGGACGAGATGCAGCCCTGG + Intergenic
926106559 2:10155787-10155809 CCAGGGAGGGGACGCAGCTCTGG - Intronic
929647010 2:43637626-43637648 CCACGGGCGCGAGGGACCGCCGG - Intronic
948140673 2:235670140-235670162 CCGCGGACGCGATGCCGCGCGGG + Intronic
1168802716 20:653422-653444 CCCCGGACGCCGCGCGGCGCAGG - Intronic
1179879076 21:44286011-44286033 CGACGGACGCGGCGCTACGCCGG + Exonic
1181165839 22:20982542-20982564 CCACGAACTCGTCGCAGGGCGGG - Exonic
1182319665 22:29470416-29470438 CCACTGATGCGACGCCGCGGCGG + Intergenic
1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG + Intronic
968674775 4:1871521-1871543 CCGAGGATGCGACGCACCGCAGG + Intronic
969328031 4:6455134-6455156 CCACGAATGCAACGCAGCTCTGG - Intronic
982489110 4:156006407-156006429 CCACAGAGGCTGCGCAGCGCTGG - Intergenic
983792302 4:171813290-171813312 ACCCGGACGCGAGGCAGCGGCGG - Intronic
985528713 5:421309-421331 CCACGGTCGCGATGCGGGGCAGG + Intronic
1003108247 6:3231525-3231547 CCACGAACGCAGCGCAGTGCGGG + Intronic
1011697421 6:89924831-89924853 CCACGGACCAGAGGCAGCGGGGG + Intergenic
1018635088 6:165854134-165854156 CCACGGGCGCAGCGCAGCGCTGG + Intronic
1029521732 7:101067078-101067100 CCAAGGGCGGGAGGCAGCGCAGG + Intergenic
1034306548 7:150048651-150048673 CCACGCACGCGCTGCGGCGCCGG + Intergenic
1034800299 7:154051992-154052014 CCACGCACGCGCTGCGGCGCCGG - Intronic
1035015998 7:155766565-155766587 CCACAGACACCACGCAGGGCTGG - Exonic
1035122253 7:156578640-156578662 CCACGCACGCCAAGCAGCCCTGG + Intergenic
1045277739 8:100722349-100722371 CCACGGACGCGACGCAGCGCGGG - Exonic
1053381312 9:37651246-37651268 CCACGGACGCGCCCCCGAGCCGG - Intronic
1189323179 X:40098176-40098198 CCGCGGAGGCGCCGCAGCGGAGG - Intronic
1190745653 X:53320612-53320634 CCACGCTCGCGACCCAGGGCTGG + Exonic
1200155321 X:153971952-153971974 CCCCCGCCGCGAGGCAGCGCAGG - Intergenic