ID: 1045278531

View in Genome Browser
Species Human (GRCh38)
Location 8:100728408-100728430
Sequence TTGCCTCAGCCTCCCAGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045278531_1045278536 6 Left 1045278531 8:100728408-100728430 CCACTACTGGGAGGCTGAGGCAA No data
Right 1045278536 8:100728437-100728459 CACTTGAGCCAGGGAGGTTGAGG 0: 58
1: 1176
2: 6556
3: 32033
4: 97472
1045278531_1045278534 -3 Left 1045278531 8:100728408-100728430 CCACTACTGGGAGGCTGAGGCAA No data
Right 1045278534 8:100728428-100728450 CAAGAGGATCACTTGAGCCAGGG 0: 22
1: 881
2: 10156
3: 36785
4: 141350
1045278531_1045278535 0 Left 1045278531 8:100728408-100728430 CCACTACTGGGAGGCTGAGGCAA No data
Right 1045278535 8:100728431-100728453 GAGGATCACTTGAGCCAGGGAGG 0: 221
1: 3448
2: 16092
3: 67518
4: 142788
1045278531_1045278533 -4 Left 1045278531 8:100728408-100728430 CCACTACTGGGAGGCTGAGGCAA No data
Right 1045278533 8:100728427-100728449 GCAAGAGGATCACTTGAGCCAGG 0: 95
1: 1361
2: 7797
3: 55799
4: 110538
1045278531_1045278537 12 Left 1045278531 8:100728408-100728430 CCACTACTGGGAGGCTGAGGCAA No data
Right 1045278537 8:100728443-100728465 AGCCAGGGAGGTTGAGGCTGCGG 0: 6
1: 120
2: 455
3: 1443
4: 7123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045278531 Original CRISPR TTGCCTCAGCCTCCCAGTAG TGG (reversed) Intergenic
No off target data available for this crispr