ID: 1045279211

View in Genome Browser
Species Human (GRCh38)
Location 8:100735161-100735183
Sequence GAGCTTCCTGCATATGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045279211_1045279217 25 Left 1045279211 8:100735161-100735183 CCCTGCCCATATGCAGGAAGCTC No data
Right 1045279217 8:100735209-100735231 TCTTTTCAAAACTTGTATTTTGG No data
1045279211_1045279219 27 Left 1045279211 8:100735161-100735183 CCCTGCCCATATGCAGGAAGCTC No data
Right 1045279219 8:100735211-100735233 TTTTCAAAACTTGTATTTTGGGG No data
1045279211_1045279218 26 Left 1045279211 8:100735161-100735183 CCCTGCCCATATGCAGGAAGCTC No data
Right 1045279218 8:100735210-100735232 CTTTTCAAAACTTGTATTTTGGG No data
1045279211_1045279220 28 Left 1045279211 8:100735161-100735183 CCCTGCCCATATGCAGGAAGCTC No data
Right 1045279220 8:100735212-100735234 TTTCAAAACTTGTATTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045279211 Original CRISPR GAGCTTCCTGCATATGGGCA GGG (reversed) Intergenic
No off target data available for this crispr