ID: 1045279217

View in Genome Browser
Species Human (GRCh38)
Location 8:100735209-100735231
Sequence TCTTTTCAAAACTTGTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045279214_1045279217 19 Left 1045279214 8:100735167-100735189 CCATATGCAGGAAGCTCGCATTT No data
Right 1045279217 8:100735209-100735231 TCTTTTCAAAACTTGTATTTTGG No data
1045279212_1045279217 24 Left 1045279212 8:100735162-100735184 CCTGCCCATATGCAGGAAGCTCG No data
Right 1045279217 8:100735209-100735231 TCTTTTCAAAACTTGTATTTTGG No data
1045279213_1045279217 20 Left 1045279213 8:100735166-100735188 CCCATATGCAGGAAGCTCGCATT No data
Right 1045279217 8:100735209-100735231 TCTTTTCAAAACTTGTATTTTGG No data
1045279211_1045279217 25 Left 1045279211 8:100735161-100735183 CCCTGCCCATATGCAGGAAGCTC No data
Right 1045279217 8:100735209-100735231 TCTTTTCAAAACTTGTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045279217 Original CRISPR TCTTTTCAAAACTTGTATTT TGG Intergenic
No off target data available for this crispr