ID: 1045279220

View in Genome Browser
Species Human (GRCh38)
Location 8:100735212-100735234
Sequence TTTCAAAACTTGTATTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045279211_1045279220 28 Left 1045279211 8:100735161-100735183 CCCTGCCCATATGCAGGAAGCTC No data
Right 1045279220 8:100735212-100735234 TTTCAAAACTTGTATTTTGGGGG No data
1045279215_1045279220 -8 Left 1045279215 8:100735197-100735219 CCTAGTCCTTTTTCTTTTCAAAA No data
Right 1045279220 8:100735212-100735234 TTTCAAAACTTGTATTTTGGGGG No data
1045279214_1045279220 22 Left 1045279214 8:100735167-100735189 CCATATGCAGGAAGCTCGCATTT No data
Right 1045279220 8:100735212-100735234 TTTCAAAACTTGTATTTTGGGGG No data
1045279212_1045279220 27 Left 1045279212 8:100735162-100735184 CCTGCCCATATGCAGGAAGCTCG No data
Right 1045279220 8:100735212-100735234 TTTCAAAACTTGTATTTTGGGGG No data
1045279213_1045279220 23 Left 1045279213 8:100735166-100735188 CCCATATGCAGGAAGCTCGCATT No data
Right 1045279220 8:100735212-100735234 TTTCAAAACTTGTATTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045279220 Original CRISPR TTTCAAAACTTGTATTTTGG GGG Intergenic
No off target data available for this crispr