ID: 1045281858

View in Genome Browser
Species Human (GRCh38)
Location 8:100756340-100756362
Sequence AGCTGAAGTGTGTTTACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045281858_1045281865 16 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281865 8:100756379-100756401 CTGCTGGGTGGAAGGCTGACGGG No data
1045281858_1045281859 0 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281859 8:100756363-100756385 GCATCCGTCTGAACTGCTGCTGG No data
1045281858_1045281860 1 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281860 8:100756364-100756386 CATCCGTCTGAACTGCTGCTGGG No data
1045281858_1045281862 4 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281862 8:100756367-100756389 CCGTCTGAACTGCTGCTGGGTGG No data
1045281858_1045281863 8 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281863 8:100756371-100756393 CTGAACTGCTGCTGGGTGGAAGG No data
1045281858_1045281864 15 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281864 8:100756378-100756400 GCTGCTGGGTGGAAGGCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045281858 Original CRISPR AGCTGAAGTGTGTTTACTCA TGG (reversed) Intergenic