ID: 1045281859

View in Genome Browser
Species Human (GRCh38)
Location 8:100756363-100756385
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045281858_1045281859 0 Left 1045281858 8:100756340-100756362 CCATGAGTAAACACACTTCAGCT No data
Right 1045281859 8:100756363-100756385 GCATCCGTCTGAACTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045281859 Original CRISPR GCATCCGTCTGAACTGCTGC TGG Intergenic
No off target data available for this crispr