ID: 1045282046

View in Genome Browser
Species Human (GRCh38)
Location 8:100757807-100757829
Sequence CCTTCCTCGCTGGGGACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045282035_1045282046 7 Left 1045282035 8:100757777-100757799 CCCAGGCTCCAATCACTACCCCA No data
Right 1045282046 8:100757807-100757829 CCTTCCTCGCTGGGGACCGCAGG No data
1045282034_1045282046 18 Left 1045282034 8:100757766-100757788 CCTGACAGACTCCCAGGCTCCAA No data
Right 1045282046 8:100757807-100757829 CCTTCCTCGCTGGGGACCGCAGG No data
1045282036_1045282046 6 Left 1045282036 8:100757778-100757800 CCAGGCTCCAATCACTACCCCAG No data
Right 1045282046 8:100757807-100757829 CCTTCCTCGCTGGGGACCGCAGG No data
1045282038_1045282046 -1 Left 1045282038 8:100757785-100757807 CCAATCACTACCCCAGGCAACTC No data
Right 1045282046 8:100757807-100757829 CCTTCCTCGCTGGGGACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045282046 Original CRISPR CCTTCCTCGCTGGGGACCGC AGG Intergenic
No off target data available for this crispr