ID: 1045282076

View in Genome Browser
Species Human (GRCh38)
Location 8:100757949-100757971
Sequence TTCCCACCACTCCCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045282076_1045282078 16 Left 1045282076 8:100757949-100757971 CCTGTCTTGGGGAGTGGTGGGAA No data
Right 1045282078 8:100757988-100758010 ATATTGCAATCACATTATAAAGG No data
1045282076_1045282080 22 Left 1045282076 8:100757949-100757971 CCTGTCTTGGGGAGTGGTGGGAA No data
Right 1045282080 8:100757994-100758016 CAATCACATTATAAAGGGCCTGG No data
1045282076_1045282079 17 Left 1045282076 8:100757949-100757971 CCTGTCTTGGGGAGTGGTGGGAA No data
Right 1045282079 8:100757989-100758011 TATTGCAATCACATTATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045282076 Original CRISPR TTCCCACCACTCCCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr