ID: 1045286556

View in Genome Browser
Species Human (GRCh38)
Location 8:100796647-100796669
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045286552_1045286556 8 Left 1045286552 8:100796616-100796638 CCTCAGCTTTTGCAGGCAAGCTA No data
Right 1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG No data
1045286549_1045286556 28 Left 1045286549 8:100796596-100796618 CCTTCTGCTTGGCTTCTCCTCCT No data
Right 1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG No data
1045286551_1045286556 11 Left 1045286551 8:100796613-100796635 CCTCCTCAGCTTTTGCAGGCAAG No data
Right 1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG No data
1045286547_1045286556 30 Left 1045286547 8:100796594-100796616 CCCCTTCTGCTTGGCTTCTCCTC No data
Right 1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG No data
1045286548_1045286556 29 Left 1045286548 8:100796595-100796617 CCCTTCTGCTTGGCTTCTCCTCC No data
Right 1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045286556 Original CRISPR GCCTTTCCTCGAGGGAGCTT TGG Intergenic