ID: 1045288943

View in Genome Browser
Species Human (GRCh38)
Location 8:100815584-100815606
Sequence GGGCAGTTTAATGTAAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045288943_1045288951 12 Left 1045288943 8:100815584-100815606 CCCCAACTTACATTAAACTGCCC No data
Right 1045288951 8:100815619-100815641 CTCCTGCTCCAGAGCCAACTTGG No data
1045288943_1045288952 13 Left 1045288943 8:100815584-100815606 CCCCAACTTACATTAAACTGCCC No data
Right 1045288952 8:100815620-100815642 TCCTGCTCCAGAGCCAACTTGGG No data
1045288943_1045288954 14 Left 1045288943 8:100815584-100815606 CCCCAACTTACATTAAACTGCCC No data
Right 1045288954 8:100815621-100815643 CCTGCTCCAGAGCCAACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045288943 Original CRISPR GGGCAGTTTAATGTAAGTTG GGG (reversed) Intergenic
No off target data available for this crispr