ID: 1045290016

View in Genome Browser
Species Human (GRCh38)
Location 8:100825052-100825074
Sequence AACCCCAGTCTGCCAATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290016_1045290029 28 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data
1045290016_1045290025 8 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290025 8:100825083-100825105 AGGGCAGTGGCTCTTGGGAATGG No data
1045290016_1045290020 -5 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290020 8:100825070-100825092 GGGTTTCCCTCTAAGGGCAGTGG No data
1045290016_1045290028 16 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290028 8:100825091-100825113 GGCTCTTGGGAATGGTCTCGGGG No data
1045290016_1045290023 2 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290023 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
1045290016_1045290027 15 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data
1045290016_1045290024 3 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG No data
1045290016_1045290026 14 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290026 8:100825089-100825111 GTGGCTCTTGGGAATGGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290016 Original CRISPR AACCCCAGTCTGCCAATGGT AGG (reversed) Intergenic