ID: 1045290017

View in Genome Browser
Species Human (GRCh38)
Location 8:100825056-100825078
Sequence GGGAAACCCCAGTCTGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290017_1045290027 11 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data
1045290017_1045290024 -1 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG No data
1045290017_1045290020 -9 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290020 8:100825070-100825092 GGGTTTCCCTCTAAGGGCAGTGG No data
1045290017_1045290026 10 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290026 8:100825089-100825111 GTGGCTCTTGGGAATGGTCTCGG No data
1045290017_1045290029 24 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data
1045290017_1045290025 4 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290025 8:100825083-100825105 AGGGCAGTGGCTCTTGGGAATGG No data
1045290017_1045290028 12 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290028 8:100825091-100825113 GGCTCTTGGGAATGGTCTCGGGG No data
1045290017_1045290023 -2 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290023 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290017 Original CRISPR GGGAAACCCCAGTCTGCCAA TGG (reversed) Intergenic
No off target data available for this crispr