ID: 1045290020

View in Genome Browser
Species Human (GRCh38)
Location 8:100825070-100825092
Sequence GGGTTTCCCTCTAAGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290017_1045290020 -9 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290020 8:100825070-100825092 GGGTTTCCCTCTAAGGGCAGTGG No data
1045290016_1045290020 -5 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290020 8:100825070-100825092 GGGTTTCCCTCTAAGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290020 Original CRISPR GGGTTTCCCTCTAAGGGCAG TGG Intergenic
No off target data available for this crispr