ID: 1045290022

View in Genome Browser
Species Human (GRCh38)
Location 8:100825077-100825099
Sequence CCAAGAGCCACTGCCCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290022_1045290027 -10 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data
1045290022_1045290028 -9 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290028 8:100825091-100825113 GGCTCTTGGGAATGGTCTCGGGG No data
1045290022_1045290029 3 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data
1045290022_1045290035 24 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290035 8:100825124-100825146 GGTCTCAGGTCAGGTCAATACGG No data
1045290022_1045290031 15 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290031 8:100825115-100825137 CTCCCCAGAGGTCTCAGGTCAGG No data
1045290022_1045290030 10 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290030 8:100825110-100825132 GGGGACTCCCCAGAGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290022 Original CRISPR CCAAGAGCCACTGCCCTTAG AGG (reversed) Intergenic
No off target data available for this crispr