ID: 1045290024

View in Genome Browser
Species Human (GRCh38)
Location 8:100825078-100825100
Sequence CTCTAAGGGCAGTGGCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290016_1045290024 3 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG No data
1045290017_1045290024 -1 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290024 Original CRISPR CTCTAAGGGCAGTGGCTCTT GGG Intergenic
No off target data available for this crispr