ID: 1045290027

View in Genome Browser
Species Human (GRCh38)
Location 8:100825090-100825112
Sequence TGGCTCTTGGGAATGGTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290021_1045290027 -9 Left 1045290021 8:100825076-100825098 CCCTCTAAGGGCAGTGGCTCTTG No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data
1045290022_1045290027 -10 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data
1045290016_1045290027 15 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data
1045290017_1045290027 11 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290027 8:100825090-100825112 TGGCTCTTGGGAATGGTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290027 Original CRISPR TGGCTCTTGGGAATGGTCTC GGG Intergenic
No off target data available for this crispr