ID: 1045290029

View in Genome Browser
Species Human (GRCh38)
Location 8:100825103-100825125
Sequence TGGTCTCGGGGACTCCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045290022_1045290029 3 Left 1045290022 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data
1045290016_1045290029 28 Left 1045290016 8:100825052-100825074 CCTACCATTGGCAGACTGGGGTT No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data
1045290017_1045290029 24 Left 1045290017 8:100825056-100825078 CCATTGGCAGACTGGGGTTTCCC No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data
1045290021_1045290029 4 Left 1045290021 8:100825076-100825098 CCCTCTAAGGGCAGTGGCTCTTG No data
Right 1045290029 8:100825103-100825125 TGGTCTCGGGGACTCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045290029 Original CRISPR TGGTCTCGGGGACTCCCCAG AGG Intergenic
No off target data available for this crispr