ID: 1045292057

View in Genome Browser
Species Human (GRCh38)
Location 8:100842170-100842192
Sequence GGTTTTGTCATTACTTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045292057_1045292058 -9 Left 1045292057 8:100842170-100842192 CCATTGAAAGTAATGACAAAACC No data
Right 1045292058 8:100842184-100842206 GACAAAACCCACAATTATTTTGG No data
1045292057_1045292062 15 Left 1045292057 8:100842170-100842192 CCATTGAAAGTAATGACAAAACC No data
Right 1045292062 8:100842208-100842230 ACTAGCCTAATAATACACAAGGG No data
1045292057_1045292063 16 Left 1045292057 8:100842170-100842192 CCATTGAAAGTAATGACAAAACC No data
Right 1045292063 8:100842209-100842231 CTAGCCTAATAATACACAAGGGG No data
1045292057_1045292061 14 Left 1045292057 8:100842170-100842192 CCATTGAAAGTAATGACAAAACC No data
Right 1045292061 8:100842207-100842229 TACTAGCCTAATAATACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045292057 Original CRISPR GGTTTTGTCATTACTTTCAA TGG (reversed) Intergenic
No off target data available for this crispr