ID: 1045296873

View in Genome Browser
Species Human (GRCh38)
Location 8:100879117-100879139
Sequence GCCACAAAGCACTAAGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045296872_1045296873 -1 Left 1045296872 8:100879095-100879117 CCATAGTAGACTCTTCTGAGTAG No data
Right 1045296873 8:100879117-100879139 GCCACAAAGCACTAAGTATCTGG No data
1045296871_1045296873 18 Left 1045296871 8:100879076-100879098 CCTAGGTAGAGCTGGGAAACCAT No data
Right 1045296873 8:100879117-100879139 GCCACAAAGCACTAAGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045296873 Original CRISPR GCCACAAAGCACTAAGTATC TGG Intergenic