ID: 1045296873 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:100879117-100879139 |
Sequence | GCCACAAAGCACTAAGTATC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1045296872_1045296873 | -1 | Left | 1045296872 | 8:100879095-100879117 | CCATAGTAGACTCTTCTGAGTAG | No data | ||
Right | 1045296873 | 8:100879117-100879139 | GCCACAAAGCACTAAGTATCTGG | No data | ||||
1045296871_1045296873 | 18 | Left | 1045296871 | 8:100879076-100879098 | CCTAGGTAGAGCTGGGAAACCAT | No data | ||
Right | 1045296873 | 8:100879117-100879139 | GCCACAAAGCACTAAGTATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1045296873 | Original CRISPR | GCCACAAAGCACTAAGTATC TGG | Intergenic | ||