ID: 1045297149

View in Genome Browser
Species Human (GRCh38)
Location 8:100882054-100882076
Sequence CCCCATGCACAGTGTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045297140_1045297149 7 Left 1045297140 8:100882024-100882046 CCATGCCCAAGAGCCAAGCCAAG No data
Right 1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG No data
1045297143_1045297149 -6 Left 1045297143 8:100882037-100882059 CCAAGCCAAGCCATGTCCCCCAT No data
Right 1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG No data
1045297141_1045297149 2 Left 1045297141 8:100882029-100882051 CCCAAGAGCCAAGCCAAGCCATG No data
Right 1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG No data
1045297142_1045297149 1 Left 1045297142 8:100882030-100882052 CCAAGAGCCAAGCCAAGCCATGT No data
Right 1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG No data
1045297139_1045297149 17 Left 1045297139 8:100882014-100882036 CCATGTCAAGCCATGCCCAAGAG No data
Right 1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045297149 Original CRISPR CCCCATGCACAGTGTCAGCA GGG Intergenic
No off target data available for this crispr