ID: 1045297373

View in Genome Browser
Species Human (GRCh38)
Location 8:100883818-100883840
Sequence GCCTTGAGCACTGCACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045297373_1045297376 -6 Left 1045297373 8:100883818-100883840 CCCAGGAGTGCAGTGCTCAAGGC No data
Right 1045297376 8:100883835-100883857 CAAGGCTGCTCCACACCGGCAGG No data
1045297373_1045297375 -10 Left 1045297373 8:100883818-100883840 CCCAGGAGTGCAGTGCTCAAGGC No data
Right 1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045297373 Original CRISPR GCCTTGAGCACTGCACTCCT GGG (reversed) Intergenic
No off target data available for this crispr